Accuri C6 Flow Cytometer System

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Christopherson, I.
Right arrow Articles by Galy, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Christopherson, I.
Right arrow Articles by Galy, A.
(Journal of Leukocyte Biology. 2001;69:675-683.)
© 2001 by Society for Leukocyte Biology

Regulation of L-selectin expression by a dominant negative Ikaros protein

Indu Christopherson, Marie Piechoki, Guo Liu, Stuart Ratner and Anne Galy

Barbara Ann Karmanos Cancer Institute, Wayne State University, Detroit, Michigan

Correspondence: Anne Galy, Ph.D., Karmanos Cancer Institute, Wayne State University, 110 E. Warren Ave., Detroit, MI 48201. E-mail: galya{at}karmanos.org


arrow
ABSTRACT
 
Ikaros family members play critical roles in hematopoietic development, yet molecules regulated by Ikaros proteins remain incompletely characterized. To determine the requirements for functional Ikaros proteins, we overexpressed Ik7, a dominant negative Ikaros protein, in human cell lines and hematopoietic progenitor cells. Ik7 is known to block the normal function of other Ikaros family members in human and mouse cells. Retroviral-mediated overexpression of Ik7 affected two distinct, migratory properties of the CEM T-cell line. Ik7 down-regulated L-selectin cell-surface expression, an effect not a result of increased shedding but of a decrease in L-selectin mRNA levels. Ik7 also reduced the spontaneous migration of CEM T cells in 3-D collagen gels. A reduction in L-selectin, cell-surface expression was also induced by Ik7 in CD34+ hematopoietic progenitor cells. In contrast, the Reh B cell line showed an up-regulation of L-selectin, cell-surface levels when expressing Ik7. For the first time, this study defines an effect of Ikaros proteins in the control of migration-related properties and shows that intact Ikaros proteins are important in a cell type-specific manner for the normal regulation of L-selectin expression.

Key Words: human • progenitor cells • dendritic cells • hematopoietic development


arrow
INTRODUCTION
 
Members of the Ikaros family of proteins play an important role in hematopoiesis as shown in animals with an Ikaros null mutation or in model systems where the normal function of Ikaros proteins is abolished by dominant negative proteins [1 2 3 4 ]. Alterations in the normal function and respective levels of Ikaros family members reduce lymphopoiesis severely and can cause leukemia and lymphoma, underscoring the importance of these proteins in the control of cell-cycle and chromosome stability of lymphocytes [1 , 5 , 6 ]. Initially described as a lymphoid-specific transcription factor with binding sites in T-cell-associated genes, it has become clear that Ikaros proteins play an important role in cells other than lymphocytes. Ikaros is found in early hematopoietic progenitor cells [7 , 8 ], and mice overexpressing a dominant negative Ikaros protein exhibit stem-cell defects constitutively [9 ]. Ikaros proteins also control the development of dendritic cell populations [3 , 4 ]. The role played by Ikaros proteins remains incompletely characterized. Ikaros proteins localize to heterochromatin regions [7 , 10 ] where they participate in higher-order chromatin complexes and control gene expression through various mechanisms [11 , 12 ]. Defining which molecules and genes are affected by Ikaros proteins is an important step in understanding the role of these proteins in hematopoietic cells. The dominant negative protein, Ik7, is the product of gene-targeting deletion of exons 3 and 4 in the wild-type Ikaros locus (Fig. 1A ), causing a strong reduction in the DNA-binding ability of the hetero-complexes formed between Ik7 and other members of the Ikaros family of proteins through their C-terminal, zinc-finger modules [13 ]. Members of the Ikaros family of proteins include Ikaros, Aiolos, Helios, Daedalus, and the newly described Eos and Pegasus [14 ]. When overexpressed in human hematopoietic progenitor cells, Ik7 causes a reduction in flt3 receptor and interferes with the production of dendritic cells in response to specific signals [4 ]. To further understand the molecular targets of Ik7, we analyzed the expression of molecules known to be important for hematopoietic cells. Large-scale analysis of human progenitor cells was precluded by the number of cells available for analysis; therefore, cell lines were tested. L-selectin is a cell-surface molecule found on leukocytes and hematopoietic progenitor cells, which recognize ligands present on endothelial cells in lymph nodes and inflammatory sites. L-selectin is critically important for cellular trafficking [15 ]. Herein, we demonstrate that Ik7 affects the expression of L-selectin in a T-cell line and in progenitor cells. Ik7 also affected migration of T cells in collagen gels. Overall, our results show for the first time that Ikaros proteins control some aspects of leukocyte migration.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. (A) Organization of the Ikaros gene. Gray boxes represent exons, and open vertical rectangles represent zinc-finger modules. Arrows indicate the localization of primers. The predicted size of products obtained with these primers by RT-PCR is indicated on the right. (B) Retroviral vectors used in the study.


arrow
MATERIALS AND METHODS
 
Retroviral vector construction and virus production
Murine Ik7 (a kind gift of Dr. Katia Georgopoulos, Harvard Medical School, Boston, MA) was cloned into the Moloney-based bicistronic, retroviral vector LZRS-IRES-EGFP [16 , 17 ] (a kind gift of Dr. Hergen Spits, Netherlands Cancer Institute, Amsterdam, The Netherlands) as described [4 ]. Briefly, the plasmid pCDM8Mik1/2 containing Ik7 was digested with EcoRI and cloned into LZRS-IRES-EGFP using standard techniques [18 ]. The constructs LZRS-Ik7-IRES-EGFP (13.6 kb) and control LZRS-IRES-EGFP (12.4 kb; Fig. 1B ) were transformed into stbl2-competent cells (Gibco BRL, Grand Island, NY), and the LZRS-Ik7-IRES-EGFP plasmid DNA was sequenced, confirming proper orientation and correct in-frame sequence (Wayne State University Macromolecular Core Facility, Detroit, MI). Plasmids were transfected into Phoenix-amphotropic packaging cells (a kind gift of Dr. G. Nolan, Stanford University, Stanford, CA), using Superfect, according to the manufacturer’s instructions (Qiagen, Valencia, CA). Transfectants were selected in puromycin (1 µg/ml) for 1 week to select for high-titer, virus-producing cells. Virus-containing supernatant was collected from confluent monolayers cultured for 48 h in R10 medium (RPMI-1640; Gibco-BRL), L-glutamine (2 mM), penicillin-streptomycin (100 U/ml and 100 µg/ml, respectively), 2-mercaptoethanol (2x10-5 M), and 10% cosmic calf serum (Hyclone, Logan, UT), filtered (0.45 µm) and cryopreseved at -80°C. The absence of helper activity and virus titers was determined by measuring enhanced green fluorescent protein (EGFP)-expressing cells after infection of the human colon carcinoma cell line HCT116 (American Type Culture Collection, Manassas, VA). Virus batches of high titer (>5x105 UEGFP/ml) were used.

Preparation of variant cell lines
T-lymphoblastic CCRF-CEM (CEM) cells (4x105 cells; a kind gift of Dr. Al-Katib, Wayne State University) were infected in one well of a 24-well plate with 0.5 ml undiluted, virus-containing supernatant by spin-infection [19 ] at 3000 g for 3 h at room temperature in the presence of 20 mM Hepes and 5 µg/ml protamine sulfate. Immediately after infection, 0.5 ml fresh R10 medium was added before returning cells to 37°C incubation. The next day, cells were washed to remove virus. Live cells expressing EGFP were sorted on a VANTAGE sorter and subsequently cultured as described above. In some experiments, cells were treated for 24 h at 37°C, 5% CO2 with various amounts of phorbol myristate acetate (Sigma Chemical Co., St. Louis, MO).

The Reh acute, B-leukemic cell line was obtained as a generous gift of Dr. A. Al-Katib (Wayne State University), and cells were cultured and transduced as described with CEM cells.

Reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was isolated using RNA isolator (Genosys, The Woodlands, TX), and reverse transcription of approximately 1 µg RNA was done at 37°C for 1 h in MMLV reaction buffer supplemented with 400 U Moloney murine leukemia virus RT in the presence of 160 U RNAsin-RNAse inhibitor, 100 nmoles dATP, dCTP, dTTP, and dGTP (Promega, Madison, WI), and 0.5 nmole random hexamers (Genosys) in 100 µl vol. Usually, 10–20 µl cDNA was amplified in PCR by 2 U Ampli-Taq DNA polymerase (Perkin Elmer, Foster City, CA) in the presence of 200 µM each dNTP, 2.5 mM MgCl2, and 1 µM (beta 2-microglobulin) or 0.25 µM (Ikaros) primers diluted in Taq reaction buffer in 100 µl vol using a personal thermocycler (Biometra, Tampa, FL) for 30 cycles (1 min at 94°C, 2 min at 55°C, and 1 min at 72°C). Primers used for the amplification of normal and mutant Ikaros isoforms cDNA are shown by arrows in Figure 1A —hex2F (5' CCCCTGTAAGCGATACTCCAGATG 3') and hEx7R (5' GATGGCTTGGTCCATCACGTGGGA 3')—and generate multiple transcripts in human cells ranging from 900 bp to 500 bp [4 , 20 ]. Primers used to detect beta 2-microglobulin mRNA were ß2MF (5' GAATTGCTATGTGTCTCGGT 3') and ß2MR (5' CATCTTCAAACCTCCATGATG 3'), generating a 257-bp product. The PCR products were stained with ethidium bromide or transferred to nylon membrane (MSI, Westboro, MA) for Southern analysis. A 32P-labeled, Ikaros-1 cDNA probe was obtained by amplification of human thymus cDNA with hex2F and hEx7R primers and labeled with the Prime-a-gene labeling system (Promega). Blot hybridization and high-stringency washes were done according to standard procedures [18 ], and radioactivity was detected on the Storm imager (Molecular Dynamics, Sunnyvale, CA).

Detection of cell-surface antigens by flow cytometry
Antibody dilution and staining buffer consisted of phosphate-buffered saline (PBS) with 0.2% bovine serum albumin (BSA) and 0.02% sodium azide. Cells were first incubated with 1 mg/ml human gamma globulin for 10 min on ice to reduce nonspecific, Fc-receptor binding, prior to adding antibodies for 30 min and washing cells twice in staining buffer. The antibodies used in the staining are listed in Table 1 . For indirect staining, cells were incubated with phycoerythrin-conjugated, goat anti-mouse antibodies (Chemicon, Temecula, CA) or with streptavidin-phycoerythrin (Becton Dickinson, San Jose, CA). After two washes, cells were resuspended in buffer with phosphatidylinositol (PI) and analyzed on the FacScan instrument. Results were expressed as percentage of live cells staining above control (control stainings with irrelevant antibodies always gave background <2%) or as mean fluorescence intensity (mfi), as determined with the PC lysis software (Becton Dickinson).


View this table:
[in this window]
[in a new window]
 
Table 1. Antibodies Used in the Study

Detection of L-selectin shedding by enzyme-linked immunosorbent assay (ELISA)
CEM T cells were cultured in R10 at the concentration of 1 x 106 cells per ml per well of a 48-well plate (Costar, Cambridge, MA) for 24 h at 37°C, 5% CO2 with varying amounts of phorbol 12-myristate 13-acetate (PMA). Cell-free supernatant was collected and tested in duplicate in a specific ELISA assay with a detection threshold of about 0.9 ng/ml, according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN).

Northern blot analysis
Total RNA was isolated as described above, and 5 µg RNA per lane was separated by electrophoresis before being stained with ethidium bromide to record RNA integrity. Gels were vaccum-blotted onto nylon membranes, subsequently hybridized with 32P-labeled human L-selectin probe. The probe consisted of a 1.2-kb DNA fragment obtained by EcoRI digestion of PCR2.1-L-selectin plasmid (a kind gift of Dr. T. Watanabe, University of Tokyo, Japan). The signal ratio between the 2.6-kb transcript and rRNA 28S was calculated with the Image Quant software (Molecular Dynamics).

Bone marrow (BM) progenitor-cell preparation and transduction
Human BM was isolated from rib fragments removed from patients undergoing thoracic surgery, according to institutional guidelines. Mononuclear cells (MNC) were prepared by centrifugation through Ficoll (Pharmacia, Piscataway, NJ) and cryopreserved with 10% dimethyl sulfoxide (DMSO) in liquid nitrogen. For preparation of CD34+ hematopoietic progenitor cells, BM-MNC were thawed in the presence of DNAse (100 U/ml) and heparin (10 U/ml; Sigma), centrifuged through Ficoll to collect viable cells at gradient interface. Cells were washed once, incubated with excess human gamma-globulins (1 mg/ml Gamimune; Miles, Eckhart, IN) to reduce nonspecific, Fc-receptor binding prior to incubation with monoclonal antibodies (mAbs) against CD34 (Qbend10; Immunotech Inc., Westbrook, ME) for 30 min on ice. After two washes, goat anti-mouse, colloidal-paramagnetic beads (Miltenyi Biotec GmBH, Sunnyvale, CA) were added, and CD34+ cells were obtained after passage through a magnetic field. Purity of the cell population was routinely >85%. The CD34+ cells were incubated at 37°C in a humidified atmosphere with 5% CO2 in R10 medium supplemented with human recombinant c-kit ligand (50 ng/ml), interleukin (IL)-6 (25 ng/ml), and IL-3 (12.5 ng/ml; kind gifts of Dr. Hill, Systemix Inc., Palo Alto, CA). After 48 h, cells were infected by spin-infection on 24-well plates coated with 8 µg/cm2 fibronectin fragments (Retronectin; Takara Biomedicals, Shiga, Japan). After centrifugation, 0.5 ml medium with cytokines was added per well, and cells were returned to 37°C. The next day, cells were washed and transferred to another plate with fresh medium and cytokines. Two days after infection, cells were stained with phycoerythrin-conjugated, anti-CD34mAbs (Caltag, Burlingame, CA) and PI (5 µg/ml) to isolate live (excluding PI), CD34+ cells expressing, or not, EGFP by cell sorting on a VANTAGE instrument (Becton Dickinson). To examine L-selectin expression, cells were stained simultaneously with sulforhodamine-conjugated, anti-CD34 mAbs (a kind gift of Dr. B. Hill, Systemix) and phycoerythrin (PE)-conjugated mAbs to CD62-L.

Collagen gel-migration assay
An acid solution of rat-tail collagen was mixed with ice-cold, concentrated RPMI 1640 medium to yield a 1.2 mg/ml collagen-monomer solution of physiological osmolality. This was pipeted into 22-mm diameter culture wells and allowed to polymerize at 37°C into gels approximately 3-mm thick. Cells were suspended in 1,2-dimethoxyethane (DME) containing 0.05%, lipid-free BSA (Sigma) and added to the wells at a density of 2 x 106 cells per cm2 gel surface. After a migration period of 16 h at 37°C, gels were fixed by addition of 33% paraformaldehyde to a final concentration of 3%. Leading-front distance was measured as the maximum depth at which >=3 cells were simultaneously in focus in a 400x field, as determined by a fine-focus adjustment, which was calibrated in µm travel. Triplicate measurements were made, each counting cells in five fields per gel. Fields were chosen randomly within a 10-mm circle whose center coincided with the center of the gel.


arrow
RESULTS
 
Retroviral-mediated expression of Ik7 in the CEM T-cell line
We introduced the mutant Ik7 dominant negative protein into CEM T cells by retroviral-mediated gene transfer to study the requirements for functional Ikaros proteins in these cells. Parental CEM T cells expressed high levels of endogenous Ikaros mRNAs as seen by RT-PCR analysis with primers spanning exons 2 and 7 of the Ikaros gene (Figs. 1A and 2 ). In particular, CEM cells expressed the DNA-binding, high molecular-weight isoform Ik1 [13 ] but did not seem to overexpress low molecular-weight, dominant negative isoforms in agreement with other studies [21 ]. For these reasons, CEM cells could be affected by the enforced expression of a dominant negative Ikaros protein potentially and thus, were used. The bi-cistronic, retroviral vector LZRS-Ik7-IRES-EGFP contains cDNA sequences encoding the highly conserved, murine Ik7 protein and EGFP (Fig. 1B) [4 ] and was used to transduce CEM T cells, generating the CEM-Ik7-EGFP cell line. A control cell line, CEM-control-EGFP, was prepared at the same time by transduction of the same parental CEM-cell stock with the LZRS-IRES-EGFP vector encoding only EGFP (Fig. 1B) . Cells expressing the transgene were detected on the basis of EGFP expression and purified twice by flow cytometry to generate homogeneous cell lines. RT-PCR analysis of the resulting cell lines confirmed that CEM-Ik7-EGFP but not the parental CEM or CEM-control-EGFP cells expressed the 467-bp product corresponding to Ik7 (Fig. 2) . Results also showed that CEM-Ik7-EGFP expressed multiple, endogenous Ikaros mRNA transcripts with patterns similar to CEM-control-EGFP or parental CEM cells, suggesting that Ik7 did not affect endogenous Ikaros gene expression severely.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Ik7 expression in CEM T-cell variants by RT-PCR. Results show ethidium-bromide staining of gels after amplification of the various isoforms of Ikaros and beta 2-microglobulin cDNAs in CEM parent and variant cells. Amplification of water was used as a negative control.

Ik7 down-regulates L-selectin surface levels and mRNA in CEM T cells
Flow cytometric analysis of mutant CEM cells was performed to determine if Ik7 induced changes in the expression of various cell-surface molecules. We found that L-selectin, which is normally expressed on all CEM cells at high levels, was down-regulated consistently by Ik7, as noted by reduced mfi of CD62-L staining (Fig. 3 ). The analysis of seven independent experiments showed consistently a partial down-regulation in the mfi in CEM-Ik7-EGFP cells compared with CEM-control-EGFP cells (Table 2 ). When directly conjugated, anti-L-selectin antibodies were used, a less-intense signal was obtained causing the shift of a greater proportion of cells below detection when expressing Ik7. Overall, in these seven experiments, the median inhibition of L-selectin expression based on staining intensity was 40%, ranging from 31% to 57%. The inhibition was statistically significant (p=0.007 by paired t-test analysis). These results suggest that fewer molecules of L-selectin were on CEM-Ik7-EGFP cell surface compared with CEM-control-EGFP cells.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Flow cytometric analysis of L-selectin expression in CEM variant cells. The top histogram represents the background staining obtained with irrelevant antibodies on CEM-control-EGFP cells (gray-filled histogram) and CEM-Ik7-EGFP (thick-lined histogram). The bottom histogram represents an overlay of CD62-L staining on these cells, and the mfi of each population is indicated.


View this table:
[in this window]
[in a new window]
 
Table 2. Cell-Surface Marker Expression of CEM Variant Cells

One mechanism for the down-regulation of L-selectin in T lymphocytes is through shedding the molecule. In T cells, L-selectin shedding can be induced by treatment with PMA [22 ]. Treatment of CEM-control-EGFP cells with increasing concentrations of PMA resulted in a dose-dependent reduction of cell-surface, L-selectin mfi by flow cytometry (Fig. 4A ) and an increase in the shedding of L-selectin in culture medium as detected by ELISA (Fig. 4B) . Culturing CEM-Ik7-EGFP cells with increasing concentrations of PMA caused further down-regulation of L-selectin on their cell surface (Fig. 4A) but only a modest augmentation in L-selectin shedding (Fig. 4B) . Noticeably, baseline shedding was lower in CEM-Ik7-EGFP cells than in CEM-control-EGFP cells, excluding the possibility that L-selectin shedding was spontaneously dysregulated by mechanisms, independent of protein kinase C activation [23]. Altogether, these results suggest that L-selectin shedding is not the mechanism involved in Ik7-induced down-regulation of L-selectin on the surface of CEM cells.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Regulation of L-selectin expression in CEM cells after PMA treatment. Variant CEM cells were treated with increasing concentrations of PMA for 24 h. Representative results of two independent experiments. (A) L-selectin, cell-surface expression measured by flow cytometry using anti-CD62-L mAbs on live cells excluding PI and expressed as mfi. (B) L-selectin shed in culture medium after 24 h as measured by ELISA.

Northern blot analysis showed that Ik7 down-regulated L-selectin mRNA levels in CEM cells (Fig. 5 ). CEM cells, like other lymphocytes, expressed two transcripts, a major species of 2.6 kb and a minor transcript at 1.7 kb, corresponding to the use of an alternative poly(A) signal sequence [24 ]. Variant CEM-Ik7-EGFP cells expressed about half the level of the major L-selectin transcript than CEM-control-EGFP cells (Fig. 5) . These results are consistent with the observed, partial down-regulation of L-selectin on the cell surface and with the detection of low amounts of shedding in medium in cells expressing Ik7. Thus, Ik7 reduces L-selectin protein and mRNA levels in CEM T cells. These results define a requirement for functional Ikaros proteins in the control of L-selectin levels.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 5. Northern blot analysis of L-selectin mRNA expression in CEM variant cells. The top blot was hybridized with an L-selectin-specific probe and shows two transcripts. The bottom blot shows the detection of 28S and 18S ribosomal RNAs by ethidium-bromide stain on a digitally converted image. Numbers indicate the ratio of signal for the 2.6-kb transcript to 28S RNA.

Ik7 down-regulates L-selectin on hematopoietic progenitor cells
L-selectin is an important cell-surface receptor that directs traffic and homing of several types of leukocytes (reviewed in [15 ]). In particular, L-selectin is found on CD34+ hematopoietic progenitor cells [25 ]. We examined if L-selectin levels of CD34+ cells were affected by Ik7. Previously, we demonstrated that CD34+ cells could be transduced with Ik7, and these studies delineated a requirement for functional Ikaros proteins in the expression of the flt-3 receptor and in differentiation of progenitor cells into dendritic cells [4 ]. As shown earlier, we infected CD34+ cells after a short culture in the presence of IL-3, c-kit ligand, and IL-6—cytokines known to promote retroviral gene transfer and maintain primitive, clonogenic-progenitor cells [26 ]. Two days after infection of CD34+ cells, 10–50% of cells in culture expressed EGFP. As partial differentiation into CD34- cells was induced by this culture step, we re-isolated CD34+ progenitor cells and purified transduced and nontransduced CD34+ cells by multi-color, flow cytometry sorting (Fig. 6A ). These sorted cell populations were used in RT-PCR to demonstrate the specific expression of Ik7 mRNA transcript in Ik7-transduced CD34+ EGFP+ (Fig. 6B , lane 2) but the lack of it in cells transduced by the control virus (lane 1) and in nontransduced cells (lanes 3 and 4). Although CD34+ cells expressed various endogenous Ikaros transcripts, we observed that the ratio of high-molecular Ik1 isoform to other isoforms was lower than in CEM T cells. Such difference in Ikaros-isoform expression between progenitor cells and T cells has already been shown in murine cells [7 ]. We determined L-selectin expression on transduced CD34+ cells two days after viral infection, using multi-color, flow cytometric analysis. Results of two independent experiments showed that Ik7 caused a 50% reduction in numbers of CD34+ cells with detectable L-selectin (Fig. 6C , from 14% to 6%), and on those cells, there was a reduction in mfi, indicating that fewer molecules of L-selectin were present per cell (Fig. 6C) . Noticeably, control cells (left dot plot) that were transduced with the control virus (EGFP+ population) had lower levels of L-selectin (14% of EGFP+ cells) than control, nontransduced cells (37% in the EGFP- cell population), suggesting that retroviral manipulation may by itself decrease L-selectin levels partially in CD34+ cells. In spite of this, comparing control-transduced (EGFP+ cells, left plot) and Ik7-transduced cells (EGFP+ cells, right plot) showed that Ik7 decreased L-selectin specifically in CD34+ cells. Thus, Ikaros proteins are important for expression of normal levels of L-selectin in hematopoietic progenitor cells and in T cells.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 6. Expression of Ik7 in human CD34+ progenitor cells and regulation of L-selectin levels. (A) CD34+ cells were infected with viruses encoding Ik7-EGFP or EGFP only; two days after infection, cells were stained with anti-CD34 mAbs to isolate progenitor cells transduced or not by flow cytometry. The two dot-plot panels on the right show cells obtained by sorting Ik7-infected but not transduced CD34+ EGFP- cells and Ik7-infected, transduced CD34+ EGFP+ cells. Numbers indicate the percentage of cells in the respective quadrants. (B) Southern blotting analysis of Ikaros mRNA in sorted CD34+ cells after RT-PCR. (C) L-selectin expression on CD34+ progenitor cells was measured two days after infection, using sulforhodamine-conjugated, anti-CD34-mAbs and phycoerythin-conjugated, anti-CD62-L mAbs, and PI dot plots were obtained after electronic gating on live cells (PI-) and CD34+ cells and represent the correlated expression of CD62-L and EGFP. Numbers in the upper-left quadrant indicate the percentage of EGFP- (nontransduced) cells that express CD62-L. Numbers in the upper-right quadrant indicate the proportion of EGFP+ (transduced) cells that express CD62-L and the mfi of this population.

Ik7 up-regulates L-selectin in the Reh B cell line
To determine if the effects of Ik7 were similar in various cell types, we analyzed cell lines expressing L-selectin. One such line, the Reh acute lymphocytic, leukemia cell line contains 20–40% cells expressing CD62-L. Reh cells were infected with control or Ik7 viruses resulting in bulk cell lines containing 30–70% EGFP+ cells. These bulk cell lines were not purified to homogeneity but were stained with L-selectin antibodies to determine expression. Results from two experiments showed that by electronic gating on EGFP+ cells, Ik7 up-regulated the number of cells expressing L-selectin (Fig. 7 ). Thus, unlike in CEM T cells, Ik7 augments L-selectin in Reh cells, showing that the control of L-selectin expression by Ikaros proteins may be cell-specific.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 7. L-selectin expression in Reh B cells by flow cytometry. One representative experiment out of two. Histogram represents L-selectin expression in cells transduced with control (left)- or Ik7 (right)-containing vectors. Analysis was done on the EGFP+ cell population selected by electronic gating.

Ik7 reduces the migration of CEM T cells in 3-D collagen gels
The density of L-selectin at the cell surface of leukocytes determines, in part, their ability to enter structures by binding to endothelial venules. The ability to migrate further into tissues is regulated by molecules other than L-selectin (reviewed in refs 15 , 27 , 28 ). An assessment of L-selectin-independent migratory properties was made by measuring the spontaneous migration of CEM T cells in 3-D collagen lattices, which mimics some of the biochemical and biophysical characteristics of migration through interstitial tissues. Spontaneously locomoting cells, such as CEM T cells, are able to penetrate into the collagen lattice by random movements in the absence of chemoattractants, using cell-matrix or biophysical interactions [29 ]. CEM cell lines were deposited onto preformed collagen lattices, and migration distance into the gel was measured after a fixed period of time (16 h). Results showed that CEM-Ik7-EGFP cells migrated significantly less far into collagen gels than CEM-control-EGFP cells or than other control CEM cells that were transfected stably with the pTracer plasmid encoding the EGFP protein (Fig. 8 ). It has been determined that the migration of locomoting T cells spontaneously in 3-D collagen gels does not involve ß1, ß2, ß3, {alpha}v, {alpha}4, {alpha}6, or CD11a integrins based on blocking studies and analysis of subcellular localization of these molecules during this process [28 , 30 ]. However, migration in 3-D collagen gels may involve VLA-2 because antibodies to CD49b ({alpha}2) inhibit the spontaneous migration of some populations of CD4+ T cells in this system [30 ]. In two separate experiments, we did not detect changes in the levels of CD49b expression in CEM-Ik7-EGFP cells compared with CEM-control-EGFP cells using immunoflow cytometry (Table 2) .



View larger version (38K):
[in this window]
[in a new window]
 
Figure 8. Migration of CEM variants in collagen gel. One representative experiment out of three. Results indicate the average ± SD of triplicate measurement of leading-edge migration of transduced CEM cells expressing Ik7 or not and of a control CEM line transfected with a plasmid encoding EGFP.

In spite of their unlikely involvement in the system, we measured the expression of CD29 ß1 integrin and CD18 ß2 integrin, which were expressed at high levels on CEM cells but not changed consistently nor significantly by Ik7 expression (for both, n=3, p>0.05 in paired t-tests; Table 2 ). CD11a (unpublished results), CD11b, and CD11c (Table 2) were expressed at low levels that were not affected by Ik7. We conclude that the diminished motility in 3-D collagen gels reflected, most likely, changes of receptor affinity or other motor protein function. We also conclude that the perturbations in migratory-related properties of CEM cells were not part of a general misregulation of cell-surface protein expression.


arrow
DISCUSSION
 
Prior studies in murine and human models have implicated Ikaros proteins in the control of cell-cycle, growth-factor receptor expression and cellular differentiation [4 , 9 , 31 ]. Our study implicates for the first time a role of Ikaros proteins in the control of migratory properties.

L-selectin is a member of the selectin family of adhesion molecules that is found on most leukocytes, mediating the early step of extravasation by facilitating leukocyte-rolling onto endothelium [15 , 27 ]. Herein, we demonstrate for the first time that Ikaros proteins are involved in the control of normal levels of L-selectin expression, because perturbations are induced by expression of a dominant negative Ikaros protein, Ik7. The down-regulation of L-selectin mRNA by Ik7 in CEM T cells suggests the possibility that Ikaros proteins may control L-selectin transcription. The transcription initiation region of L-selectin is not defined fully and may lay further than 10-kb upstream of exon 2 where the translation-initiation site is found [24 ]. However, a putative, L-selectin promoter region was identified in a region of about 900 bp flanking the 5' end of exon 2 and could be transactivated by human T-cell lymphotropic virus 1 (HTLV-1) Tax protein [32 ]. In this region, we detected two elements with Ikaros core motif sequences (GGGAA) [13 ], and throughout the gene, seven other motifs were found. Thus, it is possible that Ikaros proteins may act as direct activators of L-selectin transcription. In models of transcription using reporter genes containing consensus Ikaros binding sites, full-length Ikaros proteins such as Ik1 activate transcription, whereas truncated forms such as Ik7 interfere with transcription [13 ]. Ik7, which lacks DNA-binding, N-terminal zinc fingers (Fig. 1A) but contains intact, C-terminal zinc fingers, forms heterodimers with other Ikaros proteins, thus reducing the DNA binding of these complexes on these reporter constructs. Thus, it is conceivable that Ik7 could reduce L-selectin transcription by interfering with normal binding of Ikaros proteins on regulatory sequences in the L-selectin gene. Formal proof of this mechanism will have to be obtained in further studies. Ikaros proteins can also regulate transcription by associating with heterochromatin as shown initially in B cells [10 ], and in that context, one mechanism of suppression is by recruitment of histone deacetylase complexes to specific promoters [12 ]. Opposite effects of Ik7 were observed on different cells. Ik7 down-regulated L-selectin levels in CEM T cells and in hematopoietic progenitor cells but up-regulated L-selectin expression in Reh B cells. These observations suggest the possibility that Ikaros proteins may control L-selectin expression in a cell type-specific manner and perhaps through distinct mechanisms. In transcription models Ikaros proteins, including IK7, bind to heterologous DNA-binding domains of other proteins and can function as repressors of transcription [12 ]. The amplitude of suppression was promoter- and cell type-specific and also varied among Ikaros proteins. Thus, Ik7 could function as a repressor of L-selectin in some cells but not others. Ikaros proteins are important in the control of T-cell receptor-mediated activation [31 ]. Although CEM T cells do not express T-cell receptors on their surface, the possibility that Ikaros proteins control L-selectin expression, not through a direct effect on gene transcription but indirectly through other aspects of cell activation, must also be considered. This underlies the complex role that Ikaros proteins play in gene regulation among cells of the hematopoietic system.

The biological relevance of our observations remains to be addressed formally, but our results suggest a possible relevance in the control of migration. We show that Ik7 causes a partial but not complete reduction in L-selectin expression. The analysis of cell-surface protein levels and mRNA levels suggests approximately a 50% reduction. Although modest, this reduction could nevertheless have biological consequences because mice hemizygous for an L-selectin null mutation and therefore expressing half as much L-selectin as normal mice exhibit perturbations in migration with a 50–70% decrease in short-term entry of cells into peripheral lymphoid tissues [33 ]. To explore migratory properties further and evaluate aspects of leukocyte extravasation that are independent of L-selectin, we examined migration in collagen gels and analyzed the expression of some integrin chains on CEM T cells. We observed that Ik7 decreased migration in collagen gels but had no consistent effect on the expression of the integrin chains examined. Nevertheless, the reduced migration in collagen lattices coupled to decreased L-selectin levels suggests that a migratory syndrome defect might be occurring in cells with perturbed Ikaros function, predicting a reduced localization in hematopoietic organs. Normal Ikaros protein function is presumably perturbed in some leukemias such as T-ALL and blast-crisis chronic myelogenous leukemias (CML), because these cells over-abundantly express dominant negative isoforms of Ikaros and exhibit some mutations in the Ikaros gene [34 , 35 ]. CD34+ cells from patients with CML have decreased L-selectin expression [36 ]. Our results suggest the possibility that Ikaros dominant negative proteins could affect L-selectin expression and migration in these leukemic cells and may be relevant to their high rate of circulation. Further studies are warranted.


arrow
ACKNOWLEDGEMENTS
 
This work was supported by the American Cancer Society grant RPG-98-183-01 and by a grant from Systemix Inc. The authors are grateful to Drs. Georgopoulos, Spits, Hill, and Al-Katib for gifts of reagents and cell lines and in particular to Dr. Watanabe for his generous contribution of human L-selectin plasmid. The authors thank the Harper Operation Room staff for help in procurement of bone marrow and also acknowledge the excellent technical support provided by the Flow Cytometry Core Facility of the Karmanos Cancer Institute.

Received June 2, 2000; revised January 16, 2001; accepted January 17, 2001.


arrow
REFERENCES
 
    1
  1. Georgopoulos, K., Bigby, M., Wang, J. H., Molnar, A., Wu, P., Winandy, S., Sharpe, A. (1994) The Ikaros gene is required for the development of all lymphoid lineages Cell 79,143-156[Medline]
  2. 2
  3. Wang, J. H., Nichogiannopoulou, A., Wu, L., Sun, L., Sharpe, A., Bigby, M., Georgopoulos, K. (1996) Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation Immunity 5,537-549[Medline]
  4. 3
  5. Wu, L., Nichogiannopoulou, A., Shortman, K., Georgopoulos, K. (1997) Cell-autonomous defect in dendritic cell populations of Ikaros mutant mice point to a developmental relationship with the lymphoid lineage Immunity 7,483-492[Medline]
  6. 4
  7. Galy, A., Christopherson, I., Ferlazzo, G., Liu, G., Spits, H., Georgopoulos, K. (2000) Distinct signals control the hematopoiesis of lymphoid-related dendritic cells Blood 95,128-137[Abstract/Free Full Text]
  8. 5
  9. Wang, J. H., Avitahl, N., Cariappa, A., Friedrich, C., Keda, T., Renold, A., Andrikopoulos, K., Liang, L., Pilai, S., Morgan, B., Georgopoulos, K. (1998) Aiolos regulates B cell activation and maturation to effector state Immunity 9,543-553[Medline]
  10. 6
  11. Winandy, S., Wu, P., Georgopoulos, K. (1995) A dominant negative mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma Cell 83,289-299[Medline]
  12. 7
  13. Klug, C., Morrison, S., Masek, M., Hahm, K., Smale, S., Weissman, I. (1998) Hematopoietic stem cells and lymphoid progenitors express different Ikaros isoforms, and Ikaros is localized to heterochromatin in immature lymphocytes Proc. Natl. Acad. Sci. USA 95,657-662[Abstract/Free Full Text]
  14. 8
  15. Galy, A., Morel, F., Hill, B., Chen, B. P. (1998) Hematopoietic progenitor cells of lymphocytes and dendritic cells J. Immunother. 21,132-141
  16. 9
  17. Nichogiannopoulou, A., Trevisan, M., Neben, S., Friedrich, C., Georgopoulos, K. (1999) Defects in hemopoietic stem cell activity in Ikaros mutant mice J. Exp. Med. 190,1201-1214[Abstract/Free Full Text]
  18. 10
  19. Brown, K., Guest, S., Smale, S., Hahm, K., Merkenschlager, M., Fisher, A. (1997) Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin Cell 91,845-854[Medline]
  20. 11
  21. Kim, J., Sif, S., Jones, B., Jackson, A., Koipally, J., Heller, E., Winandy, S., Viel, A., Sawyer, A., Ikeda, T., Kingston, R., Georgopoulos, K. (1999) Ikaros DNA-binding proteins direct formation of chromatin remodeling complexes in lymphocytes Immunity 10,345-355[Medline]
  22. 12
  23. Koipally, J., Renold, A., Kim, J., Georgopoulos, K. (1999) Repression by Ikaros and Aiolos is mediated through histone deacetylase complexes EMBO J 18,3090-3100[Medline]
  24. 13
  25. Sun, L., Liu, A., Georgopoulos, K. (1996) Zinc finger-mediated protein interactions modulate Ikaros activity, a molecular control of lymphocyte development EMBO J 15,5358-5369[Medline]
  26. 14
  27. Perdomo, J., Holmes, M., Chong, B., Crossley, M. (2000) Eos and Pegasus, two members of the Ikaros family of proteins with distinct DNA binding activities J. Biol. Chem. 275,38347-38354[Abstract/Free Full Text]
  28. 15
  29. Stamenkovic, I. (1995) The L-selectin adhesion system Curr. Opin. Hematol. 2,68-75[Medline]
  30. 16
  31. Kinsella, T., Nolan, G. (1996) Episomal vectors rapidly and stably produce high-titer recombinant retrovirus Hum. Gene Ther. 7,1405-1413[Medline]
  32. 17
  33. Heemskerk, M., Blom, B., Nolan, G., Stegmann, A. P., Bakker, A., Weijer, K., Res, P., Spits, H. (1997) Inhibition of T cell and promotion of natural killer cell development by the dominant negative helix loop helix factor Id3 J. Exp. Med. 186,1597-1602[Abstract/Free Full Text]
  34. 18
  35. Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K. (1995) Current Protocols in Molecular Biology Janssen, K. eds. John Wiley & Sons New York.
  36. 19
  37. Bahnson, A. B., Dunigan, J. T., Baysal, B. E., Mohney, T., Atchison, R. W., Nimgaonkar, M. T., Ball, E. D., Barranger, J. A. (1995) Centrifugal enhancement of retroviral-mediated gene transfer J. Virol. Meth. 54,131-143[Medline]
  38. 20
  39. Molnar, A., Wu, P., Largespada, D. A., Vortkamp, A., Scherer, S., Copeland, N. G., Jenkins, N. A., Bruns, G., Georgopoulos, K. (1996) The Ikaros gene encodes a family of lymphocyte-restricted zinc finger DNA binding proteins, highly conserved in human and mouse J. Immunol. 156,585-592[Abstract]
  40. 21
  41. Hosokawa, Y., Maeda, Y., Seto, M. (2000) Low frequency of expression of dominant-negative Ikaros isoforms in human leukemia and lymphoma cell lines Leuk. Res. 24,263-264[Medline]
  42. 22
  43. Kaldjian, E. P., Stoolman, L. M. (1995) Regulation of L-selectin mRNA in Jurkat cells. Opposing influences of calcium- and protein kinase C-dependent signaling pathways J. Immunol. 154,4351-4362[Abstract]
  44. 23
  45. Stoddart, J. J., Jasuja, R., Sikorski, M., von Andrian, U., Mier, J. (1996) Protease-resistant L-selectin mutants. Down-modulation by cross-linking but not cellular activation J. Immunol. 157,5653-5659[Abstract]
  46. 24
  47. Ord, D. C., Ernst, T., Zhou, L. J., Rambaldi, A., Spertini, O., Griffin, J., Tedder, T. F. (1990) Structure of the gene encoding the human leukocyte adhesion molecule-1 (TQ1, leu-8) of lymphocytes and neutrophils J. Biol. Chem. 14,7760-7767
  48. 25
  49. Lund-Johansen, F., Terstappen, L. W. (1993) Differential surface expression of cell adhesion molecules during granulocyte maturation J. Leukoc. Biol. 54,47-55[Abstract]
  50. 26
  51. Conneally, E., Bardy, P., Eaves, C. J., Thomas, T., Chappel, S., Shpall, E. J., Humphries, R. K. (1996) Rapid and efficient selection of human hematopoietic cells expressing murine heat-stable antigen as an indicator of retroviral-mediated gene transfer Blood 87,456-464[Abstract/Free Full Text]
  52. 27
  53. Tedder, T., Steeber, D., Chen, A., Engel, P. (1995) The selectins: vascular adhesion molecules FASEB J 9,866-873[Abstract]
  54. 28
  55. Friedl, P., Brocker, E. B. (2000) The biology of cell locomotion within three-dimensional extracellular matrix Cell Mol. Life Sci. 57,41-64[Medline]
  56. 29
  57. Friedl, P., Entschladen, F., Conrad, C., Niggemann, B., Zanker, K. (1998) CD4+ T lymphocytes migrating in three-dimensional collagen lattices lack focal adhesions and utilize b1 integrin-independent strategies for polarization, interaction with collagen fibers and locomotion Eur. J. Immunol. 28,2331-2343[Medline]
  58. 30
  59. Friedl, P., Noble, P., Zanker, K. (1995) T lymphocyte locomotion in a three-dimensional collagen matrix J. Immunol. 154,4973-4985[Abstract]
  60. 31
  61. Winandy, S., Wu, L., Wang, J., Georgopoulos, K. (1999) Pre-T cell receptor (TCR) and TCR-controlled checkpoints in T cell differentiation are set by Ikaros J. Exp. Med. 190,1039-1048[Abstract/Free Full Text]
  62. 32
  63. Tatewaki, M., Yamaguchi, K., Matsuoka, M., Ishii, T., Miyasaka, M., Mori, S., Takatsuki, K., Watanabe, T. (1995) Constitutive overexpression of the L-selectin gene in fresh leukemic cells of adult T-cell leukemia that can be transactivated by human T-cell lymphotropic virus type 1 Tax Blood 86,3109-3117[Abstract/Free Full Text]
  64. 33
  65. Tang, M., Steeber, D., Zhang, X., Tedder, T. (1998) Intrinsic differences in L-selectin expression levels affect T and B lymphocyte subset-specific recirculation pathways J. Immunol. 160,5113-5121[Abstract/Free Full Text]
  66. 34
  67. Sun, L., Crotty, M., Sensel, M., Sather, H., Navara, C., Nachman, J., Steinherz, P., Gaynon, P., Seibel, N., Mao, C., Vassilev, A., Reaman, G., Uckun, F. (1999) Expression of dominant-negative Ikaros isoforms in T-cell acute lymphoblastic leukemia Clin. Cancer Res. 5,2112-2120[Abstract/Free Full Text]
  68. 35
  69. Nakayama, H., Ishimaru, F., Avitahl, N., Sezaki, N., Fujii, N., Nakase, K., Ninomiya, Y., Harashima, A., Minowada, J., Tsuchiyama, J., Imajoh, K., Tsubota, T., Fukuda, S., Sezaki, T., Kojima, K., Hara, M., Takimoto, H., Yorimitsu, S., Takahashi, I., Miyata, A., Taniguchi, S., Tokunaga, Y., Gondo, H., Niho, Y., Harada, M., et al (1999) Decreases in Ikaros activity correlate with blast crisis in patients with chronic myelogenous leukemia Cancer Res 59,3931-3934[Abstract/Free Full Text]
  70. 36
  71. Kawaishi, K., Kimura, A., Katoh, O., Sasaki, A., Oguma, N., Ihara, A., Satow, Y. (1996) Decreased L-selectin expression in CD34-positive cells from patients with chronic myelocytic leukemia Br. J. Hematol. 93,367-374[Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
S. Ezzat, X. Zhu, S. Loeper, S. Fischer, and S. L. Asa
Tumor-Derived Ikaros 6 Acetylates the Bcl-XL Promoter to Up-Regulate a Survival Signal in Pituitary Cells
Mol. Endocrinol., November 1, 2006; 20(11): 2976 - 2986.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Movassagh, D. Laderach, and A. Galy
Proteins of the Ikaros family control dendritic cell maturation required to induce optimal Th1 T cell differentiation
Int. Immunol., June 1, 2004; 16(6): 867 - 875.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. S. Perry, H. Wang, L. J. Pierce, A. M. Yang, S. Tsai, and G. J. Spangrude
L-selectin defines a bone marrow analog to the thymic early T-lineage progenitor
Blood, April 15, 2004; 103(8): 2990 - 2996.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Ezzat, S. Yu, and S. L. Asa
Ikaros Isoforms in Human Pituitary Tumors: Distinct Localization, Histone Acetylation, and Activation of the 5' Fibroblast Growth Factor Receptor-4 Promoter
Am. J. Pathol., September 1, 2003; 163(3): 1177 - 1184.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Fruehauf, J. Topaly, M. Schad, P. Paschka, H. Gschaidmeier, W. J. Zeller, A. Hochhaus, and A. D. Ho
Imatinib restores expression of CD62L in BCR-ABL-positive cells
J. Leukoc. Biol., May 1, 2003; 73(5): 600 - 603.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Christopherson, I.
Right arrow Articles by Galy, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Christopherson, I.
Right arrow Articles by Galy, A.