New Product Research Laboratories II, Daiichi Pharmaceutical Company Ltd., Tokyo, Japan
Correspondence: Keiji Kito, New Product Research Laboratories II, Daiichi Pharmaceutical Company Ltd., 1-16-13, Kitakasai, Edogawa-ku, Tokyo 134-0081, Japan. E-mail: kitok7m2{at}daiichipharm.co.jp
|
|
|---|
Key Words: chemokine CCR2 cytochalasin D
|
|
|---|
and ß, and eotaxin. CXC
chemokines act on neutrophils preferentially, and CC chemokines attract
monocytes, eosinophils, basophils, and T lymphocytes. The effects of chemokines are mediated by interaction with chemokine receptors, which belong to the superfamilies of the seven transmembrane, G-protein-coupled receptors. Chemokine receptors consist of two major subfamilies, the CXC receptors and the CC receptors, which interact with their respective chemokines. Chemokine receptors are expressed in a variety of cell populations [5 ], most receptors recognize more than one chemokine, and several chemokines can bind to more than one receptor [4 ]. CC chemokine receptor-2 (CCR2) was cloned as a MCP-1 receptor [6 ]. CCR2 interacts not only with MCP-1 but also with MCP-2 [7 , 8 ], MCP-3 [9 ], and MCP-4 [10 ], all of which have a high level of amino acid sequence homology with MCP-1. CCR2 is expressed on monocytes [11 12 13 ], basophils [14 ], activated T cells [15 ], natural killer (NK) cells [16 , 17 ], and dendritic cells [18 ].
CCR2 couples to multiple subtypes of G-proteins including Gi, Gq, G14, and G16 [19 , 20 ], and at least pertussis toxin (PTX)-sensitive G-protein has an essential role in chemotaxis induced by MCP-1 [21 , 22 ], which stimulates multiple signal transduction pathways [23 , 24 ]. These include reduction of intracellular cAMP levels [23 ], elevation of intracellular calcium [23 ] and inositol phosphate [19 , 20 ] as a result of phospholipase-C activation, release of arachidonic acid as a result of phospholipase A2 activation [25 , 26 ], and activation of the mitogen-activated protein kinase (MAPK) cascade [22 , 24 , 27 ], phosphatidylinositol 3-kinase [24 , 28 ], protein kinase C [21 ], and janus kinase-2 [29 ], most of which have been shown to be implicated in the chemotaxis induced by MCP-1.
Association of MCP-1 with monocytic cells appears to be markedly greater at 37°C than at 4°C [30 ], possibly because of the receptor internalization and uptake of the ligand at the higher temperature. However, it could not be ruled out that there is an increase in the cell-surface expression or binding affinity of the MCP-1 receptor at 37°C compared with those at 4°C, probably caused by the presence of MCP-1 at the physiological temperature. Hence, we have examined the effect of MCP-1 pre-treatment on MCP-1 binding to its receptor and proposed one possible explanation for the difference in binding at 37°C and 4°C. In the present study, we show that the MCP-1 binding to monocytic THP-1 cells and CCR2B-transfected cells is increased by pre-treatment with MCP-1, dependent on up-regulation of the receptor binding affinity and actin polymerization.
|
|
|---|
Cell culture and treatment with MCP-1
THP-1 cells maintained in RPMI 1640 (RPMI) supplemented with
10% fetal bovine serum (FBS) were washed with phosphate-buffered
saline (PBS) and resuspended in RPMI containing 0.2% bovine serum
albumin (BSA), followed by addition with MCP-1. The cells were
incubated in the absence or presence of MCP-1 for the indicated times
in a humidified atmosphere of 5% CO2 at 37°C. For the
receptor binding assay and flow cytometry, the cells were washed three
times in ice-cold PBS. CCR2B-transfected HEK-293 cells maintained in
Dulbeccos modified Eagles medium (DMEM) supplemented with 10% FBS
and G418 (0.8 mg/ml) were washed with PBS, and the medium was replaced
with DMEM containing 0.2% BSA, followed by addition with MCP-1. The
cells were incubated for the indicated times in a humidified atmosphere
of 5% CO2 at 37°C. After incubation, the cells were
collected and washed three times in ice-cold PBS for the binding
studies.
Receptor binding assay
THP-1 cells (1x106) or CCRB-transfected HEK-293
cells (0.2x106) suspended in ice-cold RPMI containing
0.2% BSA were incubated with 125I-MCP-1 for 2 h at
4°C in a total volume of 200 µl. Nonspecific binding was determined
in the presence of 100 nM nonlabeled ligand. In some experiments,
125I-MCP-1 bound to cell surface was removed by brief
exposure to ice-cold 50 mM glycine-HCl, pH 3.0, 100 mM NaCl. The cells
were collected on a glass-fiber filter (GF/C; Whatman, Clifton, NJ),
presoaked in 0.3% polyethylenimine and 0.2% BSA, followed by washing
with 3 ml of 50 mM HEPES, pH 7.4, 0.5 M NaCl. Cell-associated
radioactivity was counted as gamma emissions.
Polymerase chain reaction (PCR) analysis for CCR2 expression
Total RNA was isolated with a Micro RNA extraction kit
(Stratagene, La Jolla, CA) using the guanidinium
thiocyanate-phenol-chloroform method. Total RNA was reverse-transcribed
with a 1st-STRAND cDNA Synthesis kit (Clontech, Palo Alto, CA) using a
random primer and an Oligo-dT primer, and the resulting cDNA was used
as a template for PCR amplification. Competitive PCR analysis was
performed to quantify the CCR2 mRNA using a competitor DNA fragment
that has identical primer recognition sites for CCR2. Competitor
fragment was diluted sequentially and added to the same amount of cDNA
samples. The PCR amplification was performed for 40 cycles of 1 min at
94°C, 1 min at 58°C, and 2 min at 72°C using the primers for
CCR2: fluorescein isothiocyanate (FITC)-labeled
GGTTTATCAGAAATACCAACGAGAGC (sense primer) and CCTGAGCACATGTTGGATATGC
(anti-sense primer). The amplified DNA was resolved by agarose gel
electrophoresis and stained with ethidium bromide. The fluorescent
intensity of the amplified fragments was quantified with a Molecular
Imager (Bio-Rad, Hercules, CA), and the ratio of CCR2 to competitor was
determined.
Flow cytometry
THP-1 cells (1x106) were incubated with 50 µg/ml
anti-CCR2 antibody in 20 µl RPMI containing 0.2% BSA for 30 min at
4°C. The cells were washed with ice-cold Hanks balanced salt
solution (HBSS) buffer (Gibco BRL, Grand Island, NY) containing 0.2%
BSA and 0.1% NaN3 and incubated with a second antibody,
FITC-conjugated anti-rabbit IgG (Amersham Pharmacia Biotech), for 30
min at 4°C. After washing with ice-cold HBSS buffer, the cells were
resuspended with HBSS buffer containing 0.2% BSA and 0.1%
NaN3, and fluorescence was analyzed with FACScan flow
cytometer (Becton Dickinson, Mountain View, CA).
|
|
|---|
![]() View larger version (46K): [in a new window] |
Figure 1. The enhancement of MCP-1 binding to THP-1 cells pre-treated with MCP-1.
THP-1 cells were incubated with various concentrations of MCP-1 for
2 h (A) or with 10 ng/ml MCP-1 for the indicated time (B). The
cells washed with ice-cold PBS were subjected to binding analysis at
4°C, using 2 nM radiolabeled MCP-1. Specific binding was determined
by subtracting nonspecific binding (binding in the presence of 100 nM
unlabeled MCP-1) from total binding. The data represent the mean ± SD of triplicate determinations.
|
![]() View larger version (28K): [in a new window] |
Figure 2. Expression of CCR2 mRNA in THP-1 cells untreated or treated with MCP-1.
THP-1 cells were incubated in the absence (control) or presence of 10
ng/ml MCP-1 for 2 h. The cDNA from the cells was subjected to
competitive PCR analysis using a FITC-labeled primer to determine the
expression of CCR2 mRNA. Lanes 15 represent dilutions of the
competitor fragment (32, 9.7, 3.2, 0.97, and 0.32 fmol/ml). Amplified
DNA was resolved by agarose gel electrophoresis and stained with
ethidium bromide. The ratio of CCR2/competitor was determined by the
fluorescent intensity of the amplified fragments.
|
![]() View larger version (35K): [in a new window] |
Figure 3. Cell-surface expression of CCR2 on THP-1 cells treated with MCP-1.
THP-1 cells were incubated with various concentrations of MCP-1 for
2 h. After washing, the cells were incubated with anti-CCR2
antibody (solid lines) or control IgG (dotted lines), followed by
incubation with FITC-conjugated anti-rabbit IgG. The fluorescence
distribution (A) and mean fluorescent intensity (B) of the counted cell
populations are shown.
|
|
View this table: [in a new window] |
Table 1. Binding Characteristics of the MCP-1 Receptor on THP-1 Cells
Untreated or Treated with MCP-1a
|
![]() View larger version (16K): [in a new window] |
Figure 4. Scatchard plot analysis of MCP-1 binding to THP-1 cells and
CCR2B-transfected HEK-293 cells untreated or treated with MCP-1. THP-1
cells (A) and CCR2B-transfected HEK-293 cells (B) were untreated
(control) or treated with 10 ng/ml MCP-1 for 2 h at 37°C. The
cells were incubated with various concentrations of radiolabeled MCP-1
at 4°C, and binding was determined as described in Materials and
Methods.
|
![]() View larger version (26K): [in a new window] |
Figure 5. Effect of glycosidases on enhancement of MCP-1 binding on THP-1 cells
pre-treated with MCP-1. THP-1 cells were incubated with 10 ng/ml MCP-1
for 2 h in the absence or presence of glycosidases (0.5 unit/ml
heparinase I, 0.2 unit/ml heparinase II, 0.2 unit/ml heparinase III,
and 0.1 unit/ml chondroitinase ABC). The cells washed with ice-cold PBS
were subjected to binding analysis at 4°C, using 2 nM radiolabeled
MCP-1. Specific binding was determined by subtracting nonspecific
binding (binding in the presence of nonlabeled 100 nM MCP-1) from total
binding. The data represent the mean ± SD of
triplicate determinations.
|
![]() View larger version (58K): [in a new window] |
Figure 6. The enhancement of MCP-1 binding on CCR2B-transfected HEK-293 cells
pre-treated with MCP-1. CCR2B-transfected HEK-293 cells were incubated
with 10 ng/ml MCP-1 for the indicated times. The cells washed with
ice-cold PBS were subjected to binding analysis at 4°C, using 0.3 nM
radiolabeled MCP-1. Specific binding was determined by subtracting
nonspecific binding (binding in the presence of 20 nM unlabeled MCP-1)
from total binding. The data represent the mean ± SD
of triplicate determinations.
|
|
View this table: [in a new window] |
Table 2. Binding Characteristics of the MCP-1 Receptor on CCR2B-Transfected
HEK-293 Cells Untreated or Treated with MCP-1a
|
![]() View larger version (13K): [in a new window] |
Figure 7. Effect of cytochalasin D on MCP-1-induced up-regulation of the MCP-1
receptor binding activity on THP-1 cells and CCR2B-transfected HEK-293
cells. THP-1 cells (A) and CCR2B-transfected HEK-293 cells (B) were
treated with dimethyl sulfoxide (DMSO) alone or 1 µM cytochalasin D
in DMSO for 1 h, followed by incubation in the absence (control)
or presence of 10 ng/ml MCP-1 for 2 h. The cells washed with
ice-cold PBS were subjected to binding analysis at 4°C, using 2 nM
(THP-1 cells) or 0.3 nM (CCR2B-tranfected cells) radiolabeled MCP-1.
Specific binding was determined by subtracting nonspecific binding
(binding in the presence of 100 nM unlabeled MCP-1) from total binding.
The data represent the mean ± SD of triplicate
determinations.
|
CCR2 couples to heterotrimeric G-proteins, including Gi, Gq, G14, and G16 [19 , 20 ], and at least the activity of the PTX-sensitive G-protein is necessary for chemotaxis upon MCP-1 stimulation [21 , 22 ]. We have examined the effect of PTX on up-regulation of the MCP-1 receptor binding activity induced by MCP-1. It has been confirmed that PTX was fully active at the concentration used, by its inhibitory effect on MCP-1-induced THP-1 cell migration (unpublished results). PTX had no effect on the increase in MCP-1 binding to the THP-1 cells pre-treated with MCP-1 (Fig. 8 ), indicating that up-regulation of MCP-1 receptor binding affinity is independent of activation of a PTX-sensitive G-protein, such as Gi.
![]() View larger version (22K): [in a new window] |
Figure 8. Effect of PTX on MCP-1-induced up-regulation of the MCP-1 receptor
binding activity in THP-1 cells, which were untreated or treated with
30 ng/ml PTX for 16 h, followed by incubation in the absence
(control) or presence of 10 ng/ml MCP-1 for 2 h. The cells washed
with ice-cold PBS were subjected to binding analysis at 4°C, using 2
nM radiolabeled MCP-1. Specific binding was determined by subtracting
nonspecific binding (binding in the presence of nonlabeled 100 nM
MCP-1) from total binding. The data represent the mean ±
SD of triplicate determinations.
|
![]() View larger version (23K): [in a new window] |
Figure 9. Effects of various inhibitors for signal transduction molecules on
MCP-1-induced up-regulation of the MCP-1 receptor binding activity on
THP-1 cells, which were treated with DMSO alone or treated with 0.2
µM wortmannin for 1 h, 1 µM staurosporine for 30 min, or 10
µM U73122 for 30 min, followed by incubation in the absence (control)
or presence of 10 ng/ml MCP-1 for 2 h. The cells washed with
ice-cold PBS were subjected to binding analysis at 4°C, using 2 nM
radiolabeled MCP-1. Specific binding was determined by subtracting
nonspecific binding (binding in the presence of 100 nM unlabeled MCP-1)
from total binding. The data represent the mean ± SD
of triplicate determinations.
|
|
|
|---|
(IFN-
) and lipopolysaccharide (LPS) by decreasing mRNA stability
[11
, 12
, 39
]. In contrast,
CCR2 expression was up-regulated by native low-density lipoprotein
(LDL) and IL-10 in human monocytes [13
,
40
], and by IL-2 in T lymphocytes [15
] and
NK cells [16
]. In the current study, CCR2 mRNA and
cell-surface expression of CCR2 were not affected by MCP-1 stimulation
at 10 ng/ml (Figs. 2
and 3)
, at which MCP-1 induce maximum chemotactic
response [22
, 27
, 41
].
Conversely, the receptor binding affinity was increased sixfold on
MCP-1 pre-treated THP-1 cells (Table 1)
. The studies using
CCR2B-transfected HEK-293 cells support the conclusion that the
increase in MCP-1 binding to THP-1 cells is independent of changes at
the transcriptional level. If the increase in MCP-1 binding to THP-1
cells were dependent on the increase in the transcriptional level of
CCR2, on CCR2B-transfected HEK-293 cells MCP-1 binding was not
increased by MCP-1 treatment, because CCR2B expressed in HEK-293 cells
is regulated by the promoter and mRNA stability, which are different
from those of endogenous CCR2 expressed in THP-1 cells. In addition, it
has been ruled out that positive cooperation of MCP-1 binding is
implicated in the enhancement of MCP-1 binding on MCP-1 pre-treated
cells, because the Hill coefficient has been evaluated at 1.00 ±
0.01 and 0.97 ± 0.02 on THP-1 cells and CCR2B-transfected HEK-293
cells, respectively. Thus, in this study, we have provided the evidence
that MCP-1 receptor binding affinity is up-regulated by pre-stimulation
with MCP-1. It has been shown that actin polymerization regulates integrin-mediated neutrophil adhesion [35 ], and cytochalasin D abolishes T-cell adhesion to ICAM-1 [36 ]. Chemokines have been shown to induce actin polymerization in monocytes [42 , 43 ], T-cells [44 , 45 ], and eosinophils [46 ], which is functionally correlated with chemotaxis. We postulate that chemokine receptor binding affinity is also up-regulated via actin polymerization, upon stimulation with chemokine. Cytochalasin D abrogated the enhancement of MCP-1 receptor binding activity induced by MCP-1 pre-treatment in THP-1 cells and CCR2B-transfected HEK-293 cells (Fig. 7) . This indicates that actin polymerization has a functional role in the up-regulation of MCP-1 receptor binding activity, analogous to the integrins. The mechanism by which actin polymerization regulates the MCP-1 receptor activity, however, remains to be elucidated. In neutrophils, actin is associated with ligand-stimulated N-formyl peptide chemoattractant receptor, and interaction between the receptor and actin promotes binding of ligand to the receptor [47 , 48 ]. A direct interaction between MCP-1-activated CCR2 and actin remains to be determined. The N-formyl peptide chemoattractant receptor is a member of the superfamily of the seven transmembrane, G-protein-coupled receptors, as is the MCP-1 receptor CCR2. We speculate that when CCR2 is stimulated with MCP-1, the binding activity could be promoted by interaction with polymerized filamentous actin. However, further studies are necessary to support this hypothesis.
The MCP-1 receptor CCR2 couples to Gi, Gq, G14, and G16 [19 , 20 ], and the PTX-sensitive G-proteins, including Gi, have an essential role in chemotaxis induced by MCP-1 stimulation [21 , 22 ]. Pre-treatment of THP-1 cells with PTX had no effect on the increase in MCP-1 binding to cells stimulated with MCP-1 (Fig. 8) , indicating that the MCP-1 binding enhancement is independent of activation of PTX-sensitive G-protein, such as Gi. It is unclear whether PTX-insensitive G-proteins, which also couple to CCR2, are involved in the MCP-1-induced enhancement of the receptor binding activity.
To investigate the kinds of signaling pathways involved in
MCP-1-induced up-regulation of the MCP-1 receptor binding activity, we
examined the effects of the PI3-kinase inhibitor wortmannin, the PKC
inhibitor staurosporine, and the PLC inhibitor U73122. Among these,
neither wortmannin nor staurosporine had any effect on the increase in
MCP-1 binding to THP-1 cells pre-stimulated with MCP-1 (Fig. 9) . Actin
polymerization and cytoskeleton rearrangement induced by MCP-1 and
macrophage-inflammatory protein-1
(MIP-1
) are reduced by
wortmannin [42
, 44
], and
phosphatidylinositol triphosphate produced by PI3-kinase correlates
with actin assembly [49
]. However, the enhancement of
the MCP-1 receptor binding activity, which is dependent on actin
polymerization, was not inhibited by wortmannin, for which the reason
is currently unclear. A subtype of PI3-kinase, which is insensitive to
wortmannin, is also activated by MCP-1 stimuli [28
]. In
the THP-1 cells used in the current study, this type of PI3-kinase may
be implicated in actin polymerization and increase in the receptor
binding activity induced by MCP-1 stimulation.
In contrast, the ability of MCP-1 to increase its receptor binding
activity was inhibited partially on THP-1 cells pre-treated with the
PLC inhibitor U73122 (Fig. 9)
. This result indicates that activation of
PLC participates in some part of the signal transduction pathways that
is involved in the enhancement of the MCP-1 receptor binding affinity.
CCR2 couples to the PTX-insensitive
subunit of the Gq
class of G-proteins, which activate PLC [19
,
20
]. PTX-insensitive activation of PLC induced by MCP-1
probably has an important role in MCP-1-induced up-regulation of the
MCP-1 receptor binding activity. Rearrangement of filamentous actin
appeared to be a consequence of increased intracellular calcium
[50
]. PLC associates with filamentous actin
[51
, 52
], and phosphorylated PLC has been
shown recently to regulate reorganization of actin filaments
[53
]. In monocytes, formation of filamentous actin was
inhibited by the PLC inhibitor U73122 [43
]. These
studies suggest that PLC also regulates actin polymerization induced by
MCP-1 stimulation in our experiments.
What is the physiological role for the increase in the MCP-1 receptor binding affinity induced by MCP-1 stimulation? CCR2 and CCR5 are redistributed to the leading edge of migrating T lymphocytes in response to MCP-1 or RANTES [54 ], where the high-affinity form of the receptors may be increased. It is not known whether the redistribution of CCR2 is dependent on actin polymerization. But, actin is concentrated at the leading edge in migrating cells [55 , 56 ], suggesting the involvement of actin polymerization in receptor redistribution. Thus, our data raised a possibility that chemokine-induced, high-affinity state of the chemokine receptor, which is redistributed to the leading edge, may promote sensitivity to the chemokine gradient that induces the directed migration. Further investigation is necessary for supporting this hypothesis and clarifying the functional role for the increase in the receptor affinity.
In summary, we have shown that MCP-1 binding affinity was increased in monocytic THP-1 cells and CCR2B-transfected cells by pre-treatment with MCP-1. This increase in the MCP-1 receptor binding affinity by MCP-1 itself was dependent on actin polymerization and PLC. Although the functional role of the modulation of the receptor activity in chemotaxis remains to be elucidated, we expect that these observations contribute to understanding the mechanism of directed migration.
Received December 31, 1999; revised October 23, 2000; accepted December 3, 2000.
|
|
|---|
J. Immunol. 160,3869-3873
dimers released by activation of G
-coupled receptors Proc. Natl. Acad. Sci. USA 94,14495-14499
J. Biol. Chem. 273,25987-25995
1 binds to actin-cytoskeleton via its C-terminal SH2 domain in vitro Biochem. Biophys. Res. Commun. 228,802-806[Medline]
1 on tyrosine residue 783 by platelet-derived growth factor regulates reorganization of the cytoskeleton Exp. Cell Res. 243,113-122[Medline]This article has been cited by other articles:
![]() |
V. Govindaraju, J. G. Martin, K. Maghni, P. Ferraro, and M.-C. Michoud The Effects of Extracellular Purines and Pyrimidines on Human Airway Smooth Muscle Cells J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 941 - 948. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. Han, J. Ryu, K. H. Hong, J. Ko, Y. K. Pak, J.-B. Kim, S. W. Park, and J. J. Kim HMG-CoA Reductase Inhibition Reduces Monocyte CC Chemokine Receptor 2 Expression and Monocyte Chemoattractant Protein-1-Mediated Monocyte Recruitment In Vivo Circulation, March 22, 2005; 111(11): 1439 - 1447. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Ryu, K. H. Hong, J. H. Maeng, J.-B. Kim, J. Ko, J. Y. Park, K.-U. Lee, M. K. Hong, S. W. Park, Y. H. Kim, et al. Overexpression of Uncoupling Protein 2 in THP1 Monocytes Inhibits {beta}2 Integrin-Mediated Firm Adhesion and Transendothelial Migration Arterioscler. Thromb. Vasc. Biol., May 1, 2004; 24(5): 864 - 870. [Abstract] [Full Text] |
||||
![]() |
A.-S. W. Moller, R. Ovstebo, A.-B. Westvik, G. B. Joo, K.-B. F. Haug, and P. Kierulf Effects of bacterial cell wall components (PAMPs) on the expression of monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1{alpha} (MIP-1{alpha}) and the chemokine receptor CCR2 by purified human blood monocytes Innate Immunity, December 1, 2003; 9(6): 349 - 360. [Abstract] [PDF] |
||||
![]() |
L. Fantuzzi, F. Spadaro, G. Vallanti, I. Canini, C. Ramoni, E. Vicenzi, F. Belardelli, G. Poli, and S. Gessani Endogenous CCL2 (monocyte chemotactic protein-1) modulates human immunodeficiency virus type-1 replication and affects cytoskeleton organization in human monocyte-derived macrophages Blood, October 1, 2003; 102(7): 2334 - 2337. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||