PeproTech Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kito, K.
Right arrow Articles by Nishida, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kito, K.
Right arrow Articles by Nishida, K.
(Journal of Leukocyte Biology. 2001;69:666-674.)
© 2001 by Society for Leukocyte Biology

MCP-1 receptor binding affinity is up-regulated by pre-stimulation with MCP-1 in an actin polymerization-dependent manner

Keiji Kito, Kaoru Morishita and Kenichi Nishida

New Product Research Laboratories II, Daiichi Pharmaceutical Company Ltd., Tokyo, Japan

Correspondence: Keiji Kito, New Product Research Laboratories II, Daiichi Pharmaceutical Company Ltd., 1-16-13, Kitakasai, Edogawa-ku, Tokyo 134-0081, Japan. E-mail: kitok7m2{at}daiichipharm.co.jp


arrow
ABSTRACT
 
Monocyte chemoattractant protein-1 (MCP-1) induces monocyte chemotaxis via interaction with the MCP-1 receptor CCR2. We found that MCP-1 binding to monocytic THP-1 cells was increased by pre-treatment with MCP-1. The amount of CCR2 mRNA and the cell-surface expression of CCR2 were not affected by MCP-1 stimuli. In contrast, the MCP-1-treated THP-1 cells showed a sixfold increase in MCP-1 binding affinity compared with untreated cells. MCP-1 binding to CCR2B-transfected HEK-293 cells was also enhanced by pre-treatment with MCP-1, and MCP-1 binding affinity increased by sixfold. In both cell lines, the enhancement of MCP-1 binding by stimulation with MCP-1 was blocked by cytochalasin D, an inhibitor of actin polymerization. This effect of pre-treatment with MCP-1 is insensitive to pertussis toxin and partially blocked by U73122, an inhibitor of phospholipase C. These results demonstrate that the MCP-1 receptor binding affinity is up-regulated by MCP-1 stimuli in an actin polymerization-dependent manner.

Key Words: chemokine • CCR2 • cytochalasin D


arrow
INTRODUCTION
 
The monocyte chemoattractant protein-1 (MCP-1) was identified originally as a potent chemotactic factor for monocytes [1 2 3 ] and belongs to the super-family of chemokines [4 ]. Chemokines are 8–10 kDa-secreted proteins and function as potent chemoattractants and activators for the specific subset of leukocytes. Chemokines are grouped into two major subfamilies, the CXC chemokines, such as interleukin (IL)-8, and the CC chemokines including MCP-1, based on the absence or presence of an amino acid separating the first two cysteins. Beside MCP-1, CC chemokines include MCP-2, MCP-3, MCP-4, RANTES (regulated on activation, normal T-cell expressed and secreted), macrophage-inflammatory protein (MIP)-1{alpha} and ß, and eotaxin. CXC chemokines act on neutrophils preferentially, and CC chemokines attract monocytes, eosinophils, basophils, and T lymphocytes.

The effects of chemokines are mediated by interaction with chemokine receptors, which belong to the superfamilies of the seven transmembrane, G-protein-coupled receptors. Chemokine receptors consist of two major subfamilies, the CXC receptors and the CC receptors, which interact with their respective chemokines. Chemokine receptors are expressed in a variety of cell populations [5 ], most receptors recognize more than one chemokine, and several chemokines can bind to more than one receptor [4 ]. CC chemokine receptor-2 (CCR2) was cloned as a MCP-1 receptor [6 ]. CCR2 interacts not only with MCP-1 but also with MCP-2 [7 , 8 ], MCP-3 [9 ], and MCP-4 [10 ], all of which have a high level of amino acid sequence homology with MCP-1. CCR2 is expressed on monocytes [11 12 13 ], basophils [14 ], activated T cells [15 ], natural killer (NK) cells [16 , 17 ], and dendritic cells [18 ].

CCR2 couples to multiple subtypes of G-proteins including Gi, Gq, G14, and G16 [19 , 20 ], and at least pertussis toxin (PTX)-sensitive G-protein has an essential role in chemotaxis induced by MCP-1 [21 , 22 ], which stimulates multiple signal transduction pathways [23 , 24 ]. These include reduction of intracellular cAMP levels [23 ], elevation of intracellular calcium [23 ] and inositol phosphate [19 , 20 ] as a result of phospholipase-C activation, release of arachidonic acid as a result of phospholipase A2 activation [25 , 26 ], and activation of the mitogen-activated protein kinase (MAPK) cascade [22 , 24 , 27 ], phosphatidylinositol 3-kinase [24 , 28 ], protein kinase C [21 ], and janus kinase-2 [29 ], most of which have been shown to be implicated in the chemotaxis induced by MCP-1.

Association of MCP-1 with monocytic cells appears to be markedly greater at 37°C than at 4°C [30 ], possibly because of the receptor internalization and uptake of the ligand at the higher temperature. However, it could not be ruled out that there is an increase in the cell-surface expression or binding affinity of the MCP-1 receptor at 37°C compared with those at 4°C, probably caused by the presence of MCP-1 at the physiological temperature. Hence, we have examined the effect of MCP-1 pre-treatment on MCP-1 binding to its receptor and proposed one possible explanation for the difference in binding at 37°C and 4°C. In the present study, we show that the MCP-1 binding to monocytic THP-1 cells and CCR2B-transfected cells is increased by pre-treatment with MCP-1, dependent on up-regulation of the receptor binding affinity and actin polymerization.


arrow
MATERIALS AND METHODS
 
Biological materials
Human monocytic THP-1 cells were obtained from American Type Culture Collection (Manassas, VA) and human embryonic kidney (HEK)-293 cells stably transfected with CCR2B were a gift from Dr. I. F. Charo (University of California, San Francisco, CA). Human recombinant MCP-1 was purified from conditioned medium of Chinese hamster ovary (CHO) cells transfected with human MCP-1 cDNA, which was a generous gift from Dr. T. Yoshimura (National Cancer Institute, Frederick, MD). 125I-MCP-1 (specific activity, 2000 Ci/mmol) was purchased from Amersham Pharmacia Biotech (Buckinghamshire, U.K.). Cytochalasin-D, wortmannin, heparinase, and chondroitinase were from Sigma Chemical Co. (St. Louis, MO). Pertussis toxin, staurosporine, and U73122 were from Calbiochem (La Jolla, CA). Anti-CCR2 antibody was produced in rabbit using a synthetic peptide of human CCR2 amino acids 17–38. The immunoglobulin G (IgG) fraction, which binds to the peptide, was purified from rabbit serum by peptide-immobilized affinity chromatography and protein A affinity chromatography (Pierce Chemical Co., Rockford, IL).

Cell culture and treatment with MCP-1
THP-1 cells maintained in RPMI 1640 (RPMI) supplemented with 10% fetal bovine serum (FBS) were washed with phosphate-buffered saline (PBS) and resuspended in RPMI containing 0.2% bovine serum albumin (BSA), followed by addition with MCP-1. The cells were incubated in the absence or presence of MCP-1 for the indicated times in a humidified atmosphere of 5% CO2 at 37°C. For the receptor binding assay and flow cytometry, the cells were washed three times in ice-cold PBS. CCR2B-transfected HEK-293 cells maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS and G418 (0.8 mg/ml) were washed with PBS, and the medium was replaced with DMEM containing 0.2% BSA, followed by addition with MCP-1. The cells were incubated for the indicated times in a humidified atmosphere of 5% CO2 at 37°C. After incubation, the cells were collected and washed three times in ice-cold PBS for the binding studies.

Receptor binding assay
THP-1 cells (1x106) or CCRB-transfected HEK-293 cells (0.2x106) suspended in ice-cold RPMI containing 0.2% BSA were incubated with 125I-MCP-1 for 2 h at 4°C in a total volume of 200 µl. Nonspecific binding was determined in the presence of 100 nM nonlabeled ligand. In some experiments, 125I-MCP-1 bound to cell surface was removed by brief exposure to ice-cold 50 mM glycine-HCl, pH 3.0, 100 mM NaCl. The cells were collected on a glass-fiber filter (GF/C; Whatman, Clifton, NJ), presoaked in 0.3% polyethylenimine and 0.2% BSA, followed by washing with 3 ml of 50 mM HEPES, pH 7.4, 0.5 M NaCl. Cell-associated radioactivity was counted as gamma emissions.

Polymerase chain reaction (PCR) analysis for CCR2 expression
Total RNA was isolated with a Micro RNA extraction kit (Stratagene, La Jolla, CA) using the guanidinium thiocyanate-phenol-chloroform method. Total RNA was reverse-transcribed with a 1st-STRAND cDNA Synthesis kit (Clontech, Palo Alto, CA) using a random primer and an Oligo-dT primer, and the resulting cDNA was used as a template for PCR amplification. Competitive PCR analysis was performed to quantify the CCR2 mRNA using a competitor DNA fragment that has identical primer recognition sites for CCR2. Competitor fragment was diluted sequentially and added to the same amount of cDNA samples. The PCR amplification was performed for 40 cycles of 1 min at 94°C, 1 min at 58°C, and 2 min at 72°C using the primers for CCR2: fluorescein isothiocyanate (FITC)-labeled GGTTTATCAGAAATACCAACGAGAGC (sense primer) and CCTGAGCACATGTTGGATATGC (anti-sense primer). The amplified DNA was resolved by agarose gel electrophoresis and stained with ethidium bromide. The fluorescent intensity of the amplified fragments was quantified with a Molecular Imager (Bio-Rad, Hercules, CA), and the ratio of CCR2 to competitor was determined.

Flow cytometry
THP-1 cells (1x106) were incubated with 50 µg/ml anti-CCR2 antibody in 20 µl RPMI containing 0.2% BSA for 30 min at 4°C. The cells were washed with ice-cold Hanks’ balanced salt solution (HBSS) buffer (Gibco BRL, Grand Island, NY) containing 0.2% BSA and 0.1% NaN3 and incubated with a second antibody, FITC-conjugated anti-rabbit IgG (Amersham Pharmacia Biotech), for 30 min at 4°C. After washing with ice-cold HBSS buffer, the cells were resuspended with HBSS buffer containing 0.2% BSA and 0.1% NaN3, and fluorescence was analyzed with FACScan flow cytometer (Becton Dickinson, Mountain View, CA).


arrow
RESULTS
 
The enhancement of MCP-1 binding to THP-1 cells by pre-treatment with MCP-1
THP-1 cells, expressing the MCP-1 receptor CCR2, were treated at 37°C with various concentrations of MCP-1 for 2 h and then washed with ice-cold PBS. The cells were incubated with 2 nM 125I-MCP-1 for 2 h at 4°C. It has been confirmed that binding had achieved equilibrium at this experiment condition (unpublished results). The cell-associated 125I-MCP-1 at 4°C represents cell surface-bound MCP-1, because it was removed by exposure of cells to glycine-HCl (unpublished results). MCP-1 binding to THP-1 cells pre-treated with MCP-1 increased markedly, compared with untreated cells (Fig. 1A ). This binding enhancement was observed in a dose-dependent manner and was detected as low as 0.001 ng/ml MCP-1. The binding enhancement was maximal (fivefold) at 1–10 ng/ml MCP-1. We next investigated the time course of the increase in MCP-1 binding to THP-1 cells pre-treated with 10 ng/ml MCP-1, where its binding was increased rapidly by treatment with 10 ng/ml MCP-1, and enhancement was observed by 5 min of treatment with MCP-1 and as long as 6 h (Fig. 1B) .



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. The enhancement of MCP-1 binding to THP-1 cells pre-treated with MCP-1. THP-1 cells were incubated with various concentrations of MCP-1 for 2 h (A) or with 10 ng/ml MCP-1 for the indicated time (B). The cells washed with ice-cold PBS were subjected to binding analysis at 4°C, using 2 nM radiolabeled MCP-1. Specific binding was determined by subtracting nonspecific binding (binding in the presence of 100 nM unlabeled MCP-1) from total binding. The data represent the mean ± SD of triplicate determinations.

Effect of MCP-1 pre-treatment on CCR2 transcript and cell-surface expression of CCR2
To investigate whether induction of CCR2 expression was involved in the MCP-1 binding enhancement induced by MCP-1 pre-treatment, we determined the CCR2 transcript level and cell-surface expression of CCR2 on THP-1 cells untreated or treated with 10 ng/ml MCP-1. The CCR2 mRNA level of THP-1 cells determined by a competitive PCR method was not affected by MCP-1 treatment (Fig. 2 ). Although the cell-surface expression of CCR2 determined by flow cytometry analysis was reduced by stimulation of high dose of MCP-1 at 100–500 ng/ml as previously demonstrated [27 , 30 , 31 ], MCP-1 treatment at 10 ng/ml had no effect on cell-surface expression of CCR2 on THP-1 cells (Fig. 3 ). Thus, there were no apparent changes in the expression level of CCR2 induced by MCP-1 stimulation at 10 ng/ml. These data indicate that the increase in MCP-1 binding to THP-1 cells pre-treated with MCP-1 results from a mechanism other than up-regulation of CCR2 expression.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Expression of CCR2 mRNA in THP-1 cells untreated or treated with MCP-1. THP-1 cells were incubated in the absence (control) or presence of 10 ng/ml MCP-1 for 2 h. The cDNA from the cells was subjected to competitive PCR analysis using a FITC-labeled primer to determine the expression of CCR2 mRNA. Lanes 1–5 represent dilutions of the competitor fragment (32, 9.7, 3.2, 0.97, and 0.32 fmol/ml). Amplified DNA was resolved by agarose gel electrophoresis and stained with ethidium bromide. The ratio of CCR2/competitor was determined by the fluorescent intensity of the amplified fragments.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Cell-surface expression of CCR2 on THP-1 cells treated with MCP-1. THP-1 cells were incubated with various concentrations of MCP-1 for 2 h. After washing, the cells were incubated with anti-CCR2 antibody (solid lines) or control IgG (dotted lines), followed by incubation with FITC-conjugated anti-rabbit IgG. The fluorescence distribution (A) and mean fluorescent intensity (B) of the counted cell populations are shown.

Effect of MCP-1 pre-treatment on MCP-1 binding affinity
To assess whether MCP-1 binding affinity was changed by pre-treatment with MCP-1, we studied Scatchard analysis. Untreated, THP-1 cells bound 125I-MCP-1 with a dissociation constant (Kd) of 1.86 ± 0.28 nM, which is consistent with a previous study [32 ], whereas the MCP-1-treated cells bound 125I-MCP-1 with a Kd of 0.32 ± 0.05 nM (Table 1 and Fig. 4A ). Thus, MCP-1 binding affinity increased sixfold on THP-1 cells stimulated with MCP-1 compared with control cells. In contrast, the number of binding sites has only a slight difference between the untreated and MCP-1-treated cells. THP-1 cells untreated and treated with MCP-1 showed a maximum bound (Bmax) of 1.7 ± 0.5 fmol/106 cells and 2.7 fmol ± 0.2 fmol/106 cells, respectively (Table 1 and Fig. 4A ). This is consistent with the observations above that MCP-1 had no effect on CCR2 expression. Taken together, the data showed that enhancement of MCP-1 binding results from an increased binding affinity rather than changes in the available number of receptors.


View this table:
[in this window]
[in a new window]
 
Table 1. Binding Characteristics of the MCP-1 Receptor on THP-1 Cells Untreated or Treated with MCP-1a



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Scatchard plot analysis of MCP-1 binding to THP-1 cells and CCR2B-transfected HEK-293 cells untreated or treated with MCP-1. THP-1 cells (A) and CCR2B-transfected HEK-293 cells (B) were untreated (control) or treated with 10 ng/ml MCP-1 for 2 h at 37°C. The cells were incubated with various concentrations of radiolabeled MCP-1 at 4°C, and binding was determined as described in Materials and Methods.

MCP-1 has been shown to bind cell-surface glycosaminoglycan (GAG) via its C-terminus [33 , 34 ]. To exclude the possibility that MCP-1 pre-treatment enhanced MCP-1 bound to cell-surface GAG, we have examined the effect of glycosidases (heparinase I, heparinase II, heparinase III, and chondroitinase ABC) on enhancement of MCP-1 binding on THP-1 cells pre-treated with MCP-1, where its binding was increased by pre-stimulation with MCP-1, regardless of treatment with glycosidases (Fig. 5 ), indicating that up-regulation of MCP-1 receptor binding affinity is independent of glycosaminoglycan.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. Effect of glycosidases on enhancement of MCP-1 binding on THP-1 cells pre-treated with MCP-1. THP-1 cells were incubated with 10 ng/ml MCP-1 for 2 h in the absence or presence of glycosidases (0.5 unit/ml heparinase I, 0.2 unit/ml heparinase II, 0.2 unit/ml heparinase III, and 0.1 unit/ml chondroitinase ABC). The cells washed with ice-cold PBS were subjected to binding analysis at 4°C, using 2 nM radiolabeled MCP-1. Specific binding was determined by subtracting nonspecific binding (binding in the presence of nonlabeled 100 nM MCP-1) from total binding. The data represent the mean ± SD of triplicate determinations.

To confirm that MCP-1 binding affinity was increased by MCP-1 stimuli, we studied MCP-1 binding to HEK-293 cells stably transfected with CCR2B. MCP-1 binding to CCR2B-transfected HEK-293 cells pre-treated with MCP-1 increased markedly and rapidly (Fig. 6 ). Although untreated cells showed a MCP-1 binding affinity of 2.62 ± 0.4 nM, the cells treated with 10 ng/ml MCP-1 for 2 h showed a binding affinity of 0.40 nM ± 0.05 nM (Table 2 and Fig. 4B ). MCP-1 stimulation resulted in a sixfold increase in MCP-1 binding affinity on CCR2B-transfected cells, similar to the enhancement observed in the THP-1 cells. In contrast, there was no significant difference in the number of binding sites between untreated and MCP-1-treated cells. CCR2B-transfected cells untreated or treated with MCP-1 showed a Bmax of 5.6 fmol ± 2.1 fmol/106 cells and 4.4 fmol ± 0.5 fmol/106 cells, respectively (Table 2 and Fig. 4B ). These results revealed that the binding affinity of the MCP-1 receptor is increased by MCP-1 pre-stimulation.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 6. The enhancement of MCP-1 binding on CCR2B-transfected HEK-293 cells pre-treated with MCP-1. CCR2B-transfected HEK-293 cells were incubated with 10 ng/ml MCP-1 for the indicated times. The cells washed with ice-cold PBS were subjected to binding analysis at 4°C, using 0.3 nM radiolabeled MCP-1. Specific binding was determined by subtracting nonspecific binding (binding in the presence of 20 nM unlabeled MCP-1) from total binding. The data represent the mean ± SD of triplicate determinations.


View this table:
[in this window]
[in a new window]
 
Table 2. Binding Characteristics of the MCP-1 Receptor on CCR2B-Transfected HEK-293 Cells Untreated or Treated with MCP-1a

Involvement of actin polymerization and phospholipase C in MCP-1-induced up-regulation of MCP-1 receptor binding affinity
To explore the mechanisms by which the MCP-1 receptor binding affinity was increased by MCP-1, we investigated the effect of several inhibitors of cellular components. At first, we focused on a potential role for actin, because this is involved in the regulation of integrin-binding activity [35 , 36 ]. On THP-1 cells pre-treated with cytochalasin D, an agent that inhibits actin polymerization, pre-stimulation with MCP-1 failed to increase its binding (Fig. 7A ). Cytochalasin D had no effect on basal binding to unstimulated cells. This indicates that MCP-1 regulates its receptor binding activity through actin polymerization.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 7. Effect of cytochalasin D on MCP-1-induced up-regulation of the MCP-1 receptor binding activity on THP-1 cells and CCR2B-transfected HEK-293 cells. THP-1 cells (A) and CCR2B-transfected HEK-293 cells (B) were treated with dimethyl sulfoxide (DMSO) alone or 1 µM cytochalasin D in DMSO for 1 h, followed by incubation in the absence (control) or presence of 10 ng/ml MCP-1 for 2 h. The cells washed with ice-cold PBS were subjected to binding analysis at 4°C, using 2 nM (THP-1 cells) or 0.3 nM (CCR2B-tranfected cells) radiolabeled MCP-1. Specific binding was determined by subtracting nonspecific binding (binding in the presence of 100 nM unlabeled MCP-1) from total binding. The data represent the mean ± SD of triplicate determinations.

To confirm that actin polymerization was involved in up-regulation of the MCP-1 receptor binding activity induced by MCP-1, we examined the effect of cytochalasin D on the increase in MCP-1 binding to CCR2B-transfected HEK-293 cells pre-treated with MCP-1. Cytochalasin D inhibited the ability of MCP-1 to increase its receptor binding activity, consistent with the findings on THP-1 cells (Fig. 7B) . These studies revealed a role for actin polymerization in MCP-1-induced up-regulation of MCP-1 receptor binding affinity.

CCR2 couples to heterotrimeric G-proteins, including Gi, Gq, G14, and G16 [19 , 20 ], and at least the activity of the PTX-sensitive G-protein is necessary for chemotaxis upon MCP-1 stimulation [21 , 22 ]. We have examined the effect of PTX on up-regulation of the MCP-1 receptor binding activity induced by MCP-1. It has been confirmed that PTX was fully active at the concentration used, by its inhibitory effect on MCP-1-induced THP-1 cell migration (unpublished results). PTX had no effect on the increase in MCP-1 binding to the THP-1 cells pre-treated with MCP-1 (Fig. 8 ), indicating that up-regulation of MCP-1 receptor binding affinity is independent of activation of a PTX-sensitive G-protein, such as Gi.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 8. Effect of PTX on MCP-1-induced up-regulation of the MCP-1 receptor binding activity in THP-1 cells, which were untreated or treated with 30 ng/ml PTX for 16 h, followed by incubation in the absence (control) or presence of 10 ng/ml MCP-1 for 2 h. The cells washed with ice-cold PBS were subjected to binding analysis at 4°C, using 2 nM radiolabeled MCP-1. Specific binding was determined by subtracting nonspecific binding (binding in the presence of nonlabeled 100 nM MCP-1) from total binding. The data represent the mean ± SD of triplicate determinations.

CCR2 activates multiple molecules involved in cellular signal transduction pathways after MCP-1 stimulation [19 20 21 22 23 24 , 27 , 28 ]. These molecules include phosphatidylinositol 3-kinase (PI3-kinase), protein kinase C (PKC), and phospholipase C (PLC), which are involved in the signal transduction essential for chemotaxis. To investigate the implication of activation of these molecules in the enhancement of the MCP-1 receptor binding affinity induced by stimulation with MCP-1, we have examined the effect of wortmannin (PI3-kinase inhibitor), staurosporine (PKC inhibitor), and U73122 (PLC inhibitor). It has been confirmed that wortmannin, staurosporine, and U73122 were fully active at the concentration used, by their inhibitory effect on MCP-1-induced THP-1 cell migration (unpublished results). Neither wortmannin (PI3-kinase inhibitor) nor staurosporine (PKC inhibitor) had any effect on the increase in MCP-1 binding to THP-1 cells pre-treated with MCP-1 (Fig. 9 ). In contrast, the ability of MCP-1 to increase its receptor binding activity was inhibited significantly on THP-1 cells pre-treated with U73122, a PLC inhibitor (Fig. 9) . This indicates that activation of PLC participates in some part of the signal transduction pathway involved in up-regulation of the MCP-1 receptor binding affinity induced by MCP-1.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 9. Effects of various inhibitors for signal transduction molecules on MCP-1-induced up-regulation of the MCP-1 receptor binding activity on THP-1 cells, which were treated with DMSO alone or treated with 0.2 µM wortmannin for 1 h, 1 µM staurosporine for 30 min, or 10 µM U73122 for 30 min, followed by incubation in the absence (control) or presence of 10 ng/ml MCP-1 for 2 h. The cells washed with ice-cold PBS were subjected to binding analysis at 4°C, using 2 nM radiolabeled MCP-1. Specific binding was determined by subtracting nonspecific binding (binding in the presence of 100 nM unlabeled MCP-1) from total binding. The data represent the mean ± SD of triplicate determinations.


arrow
DISCUSSION
 
The present study demonstrated that the cell surface-bound MCP-1 was increased by pre-treatment with MCP-1 on THP-1 cells and CCR2B-transfected HEK-293 cells (Figs. 1 and 6) . It has been shown that CCR2 expression is regulated by various kinds of stimuli. CCR2 expression was reduced in THP-1 cells during differentiation to macrophage induced by PMA [37 , 38 ]. In human monocytes, CCR2 expression was inhibited by interferon-{gamma} (IFN-{gamma}) and lipopolysaccharide (LPS) by decreasing mRNA stability [11 , 12 , 39 ]. In contrast, CCR2 expression was up-regulated by native low-density lipoprotein (LDL) and IL-10 in human monocytes [13 , 40 ], and by IL-2 in T lymphocytes [15 ] and NK cells [16 ]. In the current study, CCR2 mRNA and cell-surface expression of CCR2 were not affected by MCP-1 stimulation at 10 ng/ml (Figs. 2 and 3) , at which MCP-1 induce maximum chemotactic response [22 , 27 , 41 ]. Conversely, the receptor binding affinity was increased sixfold on MCP-1 pre-treated THP-1 cells (Table 1) . The studies using CCR2B-transfected HEK-293 cells support the conclusion that the increase in MCP-1 binding to THP-1 cells is independent of changes at the transcriptional level. If the increase in MCP-1 binding to THP-1 cells were dependent on the increase in the transcriptional level of CCR2, on CCR2B-transfected HEK-293 cells MCP-1 binding was not increased by MCP-1 treatment, because CCR2B expressed in HEK-293 cells is regulated by the promoter and mRNA stability, which are different from those of endogenous CCR2 expressed in THP-1 cells. In addition, it has been ruled out that positive cooperation of MCP-1 binding is implicated in the enhancement of MCP-1 binding on MCP-1 pre-treated cells, because the Hill coefficient has been evaluated at 1.00 ± 0.01 and 0.97 ± 0.02 on THP-1 cells and CCR2B-transfected HEK-293 cells, respectively. Thus, in this study, we have provided the evidence that MCP-1 receptor binding affinity is up-regulated by pre-stimulation with MCP-1.

It has been shown that actin polymerization regulates integrin-mediated neutrophil adhesion [35 ], and cytochalasin D abolishes T-cell adhesion to ICAM-1 [36 ]. Chemokines have been shown to induce actin polymerization in monocytes [42 , 43 ], T-cells [44 , 45 ], and eosinophils [46 ], which is functionally correlated with chemotaxis. We postulate that chemokine receptor binding affinity is also up-regulated via actin polymerization, upon stimulation with chemokine. Cytochalasin D abrogated the enhancement of MCP-1 receptor binding activity induced by MCP-1 pre-treatment in THP-1 cells and CCR2B-transfected HEK-293 cells (Fig. 7) . This indicates that actin polymerization has a functional role in the up-regulation of MCP-1 receptor binding activity, analogous to the integrins. The mechanism by which actin polymerization regulates the MCP-1 receptor activity, however, remains to be elucidated. In neutrophils, actin is associated with ligand-stimulated N-formyl peptide chemoattractant receptor, and interaction between the receptor and actin promotes binding of ligand to the receptor [47 , 48 ]. A direct interaction between MCP-1-activated CCR2 and actin remains to be determined. The N-formyl peptide chemoattractant receptor is a member of the superfamily of the seven transmembrane, G-protein-coupled receptors, as is the MCP-1 receptor CCR2. We speculate that when CCR2 is stimulated with MCP-1, the binding activity could be promoted by interaction with polymerized filamentous actin. However, further studies are necessary to support this hypothesis.

The MCP-1 receptor CCR2 couples to Gi, Gq, G14, and G16 [19 , 20 ], and the PTX-sensitive G-proteins, including Gi, have an essential role in chemotaxis induced by MCP-1 stimulation [21 , 22 ]. Pre-treatment of THP-1 cells with PTX had no effect on the increase in MCP-1 binding to cells stimulated with MCP-1 (Fig. 8) , indicating that the MCP-1 binding enhancement is independent of activation of PTX-sensitive G-protein, such as Gi. It is unclear whether PTX-insensitive G-proteins, which also couple to CCR2, are involved in the MCP-1-induced enhancement of the receptor binding activity.

To investigate the kinds of signaling pathways involved in MCP-1-induced up-regulation of the MCP-1 receptor binding activity, we examined the effects of the PI3-kinase inhibitor wortmannin, the PKC inhibitor staurosporine, and the PLC inhibitor U73122. Among these, neither wortmannin nor staurosporine had any effect on the increase in MCP-1 binding to THP-1 cells pre-stimulated with MCP-1 (Fig. 9) . Actin polymerization and cytoskeleton rearrangement induced by MCP-1 and macrophage-inflammatory protein-1{alpha} (MIP-1{alpha}) are reduced by wortmannin [42 , 44 ], and phosphatidylinositol triphosphate produced by PI3-kinase correlates with actin assembly [49 ]. However, the enhancement of the MCP-1 receptor binding activity, which is dependent on actin polymerization, was not inhibited by wortmannin, for which the reason is currently unclear. A subtype of PI3-kinase, which is insensitive to wortmannin, is also activated by MCP-1 stimuli [28 ]. In the THP-1 cells used in the current study, this type of PI3-kinase may be implicated in actin polymerization and increase in the receptor binding activity induced by MCP-1 stimulation.

In contrast, the ability of MCP-1 to increase its receptor binding activity was inhibited partially on THP-1 cells pre-treated with the PLC inhibitor U73122 (Fig. 9) . This result indicates that activation of PLC participates in some part of the signal transduction pathways that is involved in the enhancement of the MCP-1 receptor binding affinity. CCR2 couples to the PTX-insensitive {alpha}–subunit of the Gq class of G-proteins, which activate PLC [19 , 20 ]. PTX-insensitive activation of PLC induced by MCP-1 probably has an important role in MCP-1-induced up-regulation of the MCP-1 receptor binding activity. Rearrangement of filamentous actin appeared to be a consequence of increased intracellular calcium [50 ]. PLC associates with filamentous actin [51 , 52 ], and phosphorylated PLC has been shown recently to regulate reorganization of actin filaments [53 ]. In monocytes, formation of filamentous actin was inhibited by the PLC inhibitor U73122 [43 ]. These studies suggest that PLC also regulates actin polymerization induced by MCP-1 stimulation in our experiments.

What is the physiological role for the increase in the MCP-1 receptor binding affinity induced by MCP-1 stimulation? CCR2 and CCR5 are redistributed to the leading edge of migrating T lymphocytes in response to MCP-1 or RANTES [54 ], where the high-affinity form of the receptors may be increased. It is not known whether the redistribution of CCR2 is dependent on actin polymerization. But, actin is concentrated at the leading edge in migrating cells [55 , 56 ], suggesting the involvement of actin polymerization in receptor redistribution. Thus, our data raised a possibility that chemokine-induced, high-affinity state of the chemokine receptor, which is redistributed to the leading edge, may promote sensitivity to the chemokine gradient that induces the directed migration. Further investigation is necessary for supporting this hypothesis and clarifying the functional role for the increase in the receptor affinity.

In summary, we have shown that MCP-1 binding affinity was increased in monocytic THP-1 cells and CCR2B-transfected cells by pre-treatment with MCP-1. This increase in the MCP-1 receptor binding affinity by MCP-1 itself was dependent on actin polymerization and PLC. Although the functional role of the modulation of the receptor activity in chemotaxis remains to be elucidated, we expect that these observations contribute to understanding the mechanism of directed migration.


arrow
ACKNOWLEDGEMENTS
 
We thank Dr. I. F. Charo for HEK-293 cells stably transfected with CCR2B and for his generous suggestions.

Received December 31, 1999; revised October 23, 2000; accepted December 3, 2000.


arrow
REFERENCES
 
    1
  1. Furutani, Y., Nomura, H., Notake, M., Oyamada, Y., Fukui, T., Yamada, M., Larsen, C. G., Oppenheim, J. J., Matsushima, K. (1989) Cloning and sequencing of the cDNA for human monocyte chemotactic and activating factor (MCAF) Biochem. Biophys. Res. Commun. 159,249-255[Medline]
  2. 2
  3. Yoshimura, T., Robinson, E. A., Tanaka, S., Appella, E., Kuratsu, J., Leonard, E. J. (1989) Purification and amino acid analysis of two human glioma-derived monocyte chemoattractants J. Exp. Med. 169,1449-1459[Abstract/Free Full Text]
  4. 3
  5. Yosimura, T., Yuhki, N., Moore, S. K., Appella, E., Lerman, M. I., Leonard, E. J. (1989) Human monocyte chemoattractant protein-1 (MCP-1): full-length cDNA cloning, expression in mitogen-stimulated blood mononuclear leukocytes, and sequence similarity to mouse competence gene JE FEBS Lett 244,487-493[Medline]
  6. 4
  7. Baggiolini, M. (1998) Chemokines and leukocyte traffic Nature 392,565-568[Medline]
  8. 5
  9. Sallusto, F., Lanzavecchia, A., Mackay, C. R. (1998) Chemokines and chemokine receptors in T-cell priming and Th1/Th2-mediated responses Immunol. Today 19,568-574[Medline]
  10. 6
  11. Charo, I. F., Myers, S. J., Herman, A., Franci, C., Connolly, A. J., Coughlin, S. R. (1994) Molecular cloning and functional expression of two monocyte chemoattractant protein 1 receptors reveals alternative splicing of the carboxyl-terminal tails Proc. Natl. Acad. Sci. USA 91,2752-2756[Abstract/Free Full Text]
  12. 7
  13. Yamagami, S., Tanaka, H., Endo, N. (1997) Monocyte chemoattractant protein-2 can exert its effects through the MCP-1 receptor (CC CKR2B) FEBS Lett 400,329-332[Medline]
  14. 8
  15. Moore, U. M., Kaplow, J. M., Pleass, R. D., Castro, S. W., Naik, K., Lynch, C. N., Daly, S., Roach, A. G., Jaye, M., Williams, R. J. (1997) Monocyte chemoattractant protein-2 is a potent agonist of CCR2B J. Leukoc. Biol. 62,911-915[Abstract]
  16. 9
  17. Combadiere, C., Ahuja, S. K., Van Damme, J., Tiffany, H. L., Gao, J. L., Murphy, P. M. (1995) Monocyte chemoattractant protein-3 is a functional ligand for CC chemokine receptors 1 and 2B J. Biol. Chem. 270,29671-29675[Abstract/Free Full Text]
  18. 10
  19. Berkhout, T. A., Sarau, H. M., Moores, K., White, J. R., Elshourbagy, N., Appelbaum, E., Reape, R. J., Brawner, M., Makwana, J., Foley, J. J., Schmidt, D. B., Imburgia, C., McNulty, D., Matthews, J., O’Donnell, K., O’Shannessy, D., Scott, M., Groot, P. H. E., Macphee, C. (1997) Cloning, in vitro expression, and functional characterization of a novel human CC chemokine of the monocyte chemotactic protein (MCP) family (MCP-4) that binds and signals through the CC chemokine receptor 2B J. Biol. Chem. 272,16404-16411[Abstract/Free Full Text]
  20. 11
  21. Sica, A., Saccani, A., Borsatti, A., Power, C. A., Wells, T. N., Luini, W., Polentarutti, N., Sozzani, S., Mantovani, A. (1997) Bacterial lipopolysaccharide rapidly inhibits expression of C-C chemokine receptors in human monocytes J. Exp. Med. 185,969-974[Abstract/Free Full Text]
  22. 12
  23. Penton-Rol, G., Polentarutti, N., Luini, W., Borsatti, A., Mancinelli, R., Sica, A., Sozzani, S., Mantovani, A. (1998) Selective inhibition of expression of the chemokine receptor CCR2 in human monocytes by IFN-{gamma} J. Immunol. 160,3869-3873[Abstract/Free Full Text]
  24. 13
  25. Sozzani, S., Ghezzi, S., Iannolo, G., Luini, W., Borsatti, A., Polentarutti, N., Sica, A., Locati, M., Mackay, C., Wells, T. N., Biswas, P., Vicenzi, E., Poli, G., Mantovani, A. (1998) Interleukin 10 increases CCR5 expression and HIV infection in human monocytes J. Exp. Med. 187,439-444[Abstract/Free Full Text]
  26. 14
  27. Frade, J. M., Mellado, M., del Real, G., Gutierrez-Ramos, J. C., Lind, P., Martinez-A, C. (1997) Characterization of the CCR2 chemokine receptor: functional CCR2 receptor expression in B cells J. Immunol. 159,5576-5584[Abstract]
  28. 15
  29. Loetscher, P., Seitz, M., Baggiolini, M., Moser, B. (1996) Interleukin-2 regulates CC chemokine receptor expression and chemotactic responsiveness in T lymphocytes J. Exp. Med. 184,569-577[Abstract/Free Full Text]
  30. 16
  31. Polentarutti, N., Allavena, P., Bianchi, G., Giardina, G., Basile, A., Sozzani, S., Mantovani, A., Introna, M. (1997) IL-2-regulated expression of the monocyte chemotactic protein-1 receptor (CCR2) in human NK cells: characterization of a predominant 3.4-kilobase transcript containing CCR2B and CCR2A sequences J. Immunol. 158,2689-2694[Abstract]
  32. 17
  33. Nieto, M., Navarro, F., Perez-Villar, J. J., del Pozo, M. A., Gonzalez-Amaro, R., Mellado, M., Frade, J. M., Martinez-A, C., Lopez-Botet, M., Sanchez-Madrid, F. (1998) Roles of chemokines and receptor polarization in NK-target cell interactions J. Immunol. 161,3330-3339[Abstract/Free Full Text]
  34. 18
  35. Sozzani, S., Luini, W., Borsatti, A., Polentarutti, N., Zhou, D., Piemonti, L., D’Amico, G., Power, C. A., Wells, T. N., Gobbi, M., Allavena, P., Mantovani, A. (1997) Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokines J. Immunol. 159,1993-2000[Abstract]
  36. 19
  37. Arai, H., Charo, I. F. (1996) Differential regulation of G-protein-mediated signaling by chemokine receptors J. Biol. Chem. 271,21814-21819[Abstract/Free Full Text]
  38. 20
  39. Kuang, Y., Wu, Y., Jiang, H., Wu, D. (1996) Selective G protein coupling by C-C chemokine receptors J. Biol. Chem. 271,3975-3978[Abstract/Free Full Text]
  40. 21
  41. Sozzani, S., Luini, W., Molino, M., Jilek, P., Bottazzi, B., Cerletti, C., Matsushima, K., Mantovani, A. (1991) The signal transduction pathway involved in the migration induced by a monocyte chemotactic cytokine J. Immunol. 147,2215-2221[Abstract]
  42. 22
  43. Arai, H., Tsou, C. L., Charo, I. F. (1997) Chemotaxis in a lymphocyte cell line transfected with C-C chemokine receptor 2B: evidence that directed migration is mediated by ß{gamma} dimers released by activation of G{alpha}-coupled receptors Proc. Natl. Acad. Sci. USA 94,14495-14499[Abstract/Free Full Text]
  44. 23
  45. Myers, S. J., Wong, L. M., Charo, I. F. (1995) Signal transduciton and ligand specificity of the human monocyte chemoattractant protein-1 receptor in transfected embryonic kidney cells J. Biol. Chem. 270,5786-5792[Abstract/Free Full Text]
  46. 24
  47. Yen, H., Zhang, Y., Penfold, S., Rollins, B. J. (1997) MCP-1-mediated chemotaxis requires activation of non-overlapping signal transduction pathways J. Leukoc. Biol. 61,529-532[Abstract]
  48. 25
  49. Locati, M., Zhou, D., Luini, W., Evangelista, V., Mantovani, A., Sozzani, S. (1994) Rapid induction of arachidonic acid release by monocyte chemotactic protein-1 and related chemokines. Role of Ca2+ influx, synergism with platelet-activating factor and significance for chemotaxis J. Biol. Chem./TITLE> 269,4746-4753[Abstract/Free Full Text]
  50. 26
  51. Locati, M., Lamorte, G., Luini, W., Introna, M., Bernasconi, S., Mantovani, A., Sozzani, S. (1996) Inhibition of monocyte chemotaxis to C-C chemokines by antisense oligonucleotide for cytosolic phospholipase A2 J. Biol. Chem. 271,6010-6016[Abstract/Free Full Text]
  52. 27
  53. Arai, H., Monteclaro, F. S., Tsou, C. L., Franci, C., Charo, I. F. (1997) Dissociation of chemotaxis from agonist-induced receptor internalization in a lymphocyte cell line transfected with CCR2B. Evidence that directed migration does not require rapid modulation of signaling at the receptor level J. Biol. Chem. 272,25037-25042[Abstract/Free Full Text]
  54. 28
  55. Turner, S. J., Domin, J., Waterfield, M. D., Ward, S. G., Westwick, J. (1998) The CC chemokine monocyte chemotactic peptide-1 activates both the class I p85/p110 phosphatidylinositol 3-kinase and the class II PI3K-C2{alpha} J. Biol. Chem. 273,25987-25995[Abstract/Free Full Text]
  56. 29
  57. Mellado, M., Rodriguez-Frade, J. M., Aragay, A., del Real, G., Martin, A. M., Vila-Coro, A. J., Serrano, A., Mayor, F., Jr, Martinez-A, C. (1998) The chemokine monocyte chemotactic protein 1 triggers Janus kinase 2 activation and tyrosine phosphorylation of the CCR2B receptor J. Immunol. 161,805-813[Abstract/Free Full Text]
  58. 30
  59. Wang, J. M., Hishinuma, A., Oppenheim, J. J., Matsushima, K. (1993) Studies of binding and internalization of human recombinant monocyte chemotactic and activating factor (MCAF) by monocytic cells Cytokine 5,264-275[Medline]
  60. 31
  61. Franci, C., Gosling, J., Tsou, C. L., Coughlin, S. R., Charo, I. F. (1996) Phosphorylation by a G protein-coupled kinase inhibits signaling and promotes internalization of the monocyte chemoattractant protein-1 receptor. Critical role of carboxyl-tail serines/threonines in receptor function J. Immunol. 157,5606-5612[Abstract]
  62. 32
  63. Gong, J. H., Uguccioni, M., Dewald, B., Baggiolini, M., Clark-Lewis, I. (1996) RANTES and MCP-3 antagonists bind multiple chemokine receptors J. Biol. Chem. 271,10521-10527[Abstract/Free Full Text]
  64. 33
  65. Hoogewerf, A. J., Kuschert, G. S., Proudfoot, A. E., Borlat, F., Clark-Lewis, I., Power, C. A., Wells, T. N. (1997) Glycosaminoglycans mediate cell surface oligomerization of chemokines Biochemistry 36,13570-13578[Medline]
  66. 34
  67. Chakravarty, L., Rogers, L., Quach, T., Breckenridge, S., Kolattukudy, P. E. (1998) Lysine 58 and histidine 66 at the C-terminal alpha-helix of monocyte chemoattractant protein-1 are essential for glycosaminoglycan binding J. Biol. Chem. 273,29641-29647[Abstract/Free Full Text]
  68. 35
  69. Sheikh, S., Gratzer, W. B., Pinder, J. C., Nash, G. B. (1997) Actin polymerisation regulates integrin-mediated adhesion as well as rigidity of neutrophils Biochem. Biophys. Res. Commun. 238,910-915[Medline]
  70. 36
  71. Stewart, M. P., Cabanas, C., Hogg, N. (1996) T cell adhesion to intercellular adhesion molecule-1 (ICAM-1) is controlled by cell spreading and the activation of integrin LFA-1 J. Immunol. 156,1810-1817[Abstract]
  72. 37
  73. Denholm, E. M., Stankus, G. P. (1995) Changes in the expression of MCP-1 receptors on monocytic THP-1 cells following differentiation to macrophages with phorbol myristate acetate Cytokine 7,436-440[Medline]
  74. 38
  75. Tangirala, R. K., Murao, K., Quehenberger, O. (1997) Regulation of expression of the human monocyte chemotactic protein-1 receptor (hCCR2) by cytokines J. Biol. Chem. 272,8050-8056[Abstract/Free Full Text]
  76. 39
  77. Xu, L., Rahimpour, R., Ran, L., Kong, C., Biragyn, A., Andrews, J., Devries, M., Wang, J. M., Kelvin, D. J. (1997) Regulation of CCR2 chemokine receptor mRNA stability J. Leukoc. Biol. 62,653-660[Abstract]
  78. 40
  79. Han, K. H., Tangirala, R. K., Green, S. R., Quehenberger, O. (1998) Chemokine receptor CCR2 expression and monocyte chemoattractant protein-1-mediated chemotaxis in human monocytes. A regulatory role for plasma LDL Arterioscler. Thromb. Vasc. Biol. 18,1983-1991[Abstract/Free Full Text]
  80. 41
  81. Yoshimura, T., Leonard, E. J. (1990) Identification of high affinity receptors for human monocyte chemoattractant protein-1 on human monocytes J. Immunol. 145,292-297[Abstract]
  82. 42
  83. Weber, K. S., Klickstein, L. B., Weber, P. C., Weber, C. (1998) Chemokine-induced monocyte transmigration requires cdc42-mediated cytoskeletal changes Eur. J. Immunol. 28,2245-2251[Medline]
  84. 43
  85. Nardelli, B., Tiffany, H. L., Bong, G. W., Yourey, P. A., Morahan, D. K., Li, Y., Murphy, P. M., Alderson, R. F. (1999) Characterization of the signal transduction pathway activated in human monocytes and dendritic cells by MPIF-1, a specific ligand for CC chemokine receptor 1 J. Immunol. 162,435-444[Abstract/Free Full Text]
  86. 44
  87. Tanaka, Y., Mine, S., Figdor, C. G., Wake, A., Hirano, H., Tsukada, J., Aso, M., Fujii, K., Saito, K., van Kooyk, Y., Eto, S. (1998) Constitutive chemokine production results in activation of leukocyte function-associated antigen-1 on adult T-cell leukemia cells Blood 91,3909-3919[Abstract/Free Full Text]
  88. 45
  89. Adams, D. H., Harvath, L., Bottaro, D. P., Interrante, R., Catalano, G., Tanaka, Y., Strain, A., Hubscher, S. G., Shaw, S. (1994) Hepatocyte growth factor and macrophage inflammatory protein 1 ß: structurally distinct cytokines that induce rapid cytoskeletal changes and subset-preferential migration in T cells Proc. Natl. Acad. Sci. USA 91,7144-7148[Abstract/Free Full Text]
  90. 46
  91. Tenscher, K., Metzner, B., Hofmann, C., Schopf, E., Norgauer, J. (1997) The monocyte chemotactic protein-4 induces oxygen radical production, actin reorganization, and CD11b up-regulation via a pertussis toxin-sensitive G-protein in human eosinophils Biochem. Biophys. Res. Commun. 240,32-35[Medline]
  92. 47
  93. Jesaitis, A. J., Erickson, R. W., Klotz, K. N., Bommakanti, R. K., Siemsen, D. W. (1993) Functional molecular complexes of human N-formyl chemoattractant receptors and actin J. Immunol. 151,5653-5665[Abstract]
  94. 48
  95. Klotz, K. N., Krotec, K. L., Gripentrog, J., Jesaitis, A. J. (1994) Regulatory interaction of N-formyl peptide chemoattractant receptors with the membrane skeleton in human neutrophils J. Immunol. 152,801-810[Abstract]
  96. 49
  97. Bokoch, G. M. (1995) Chemoattractant signaling and leukocyte activation Blood 86,1649-1660[Free Full Text]
  98. 50
  99. Rodriguez, A., Rioult, M. G., Ora, A., Andrews, N. W. (1995) A trypanosome-soluble factor induces IP3 formation, intracellular Ca2+ mobilization and microfilament rearrangement in host cells J. Cell Biol. 129,1263-1273[Abstract/Free Full Text]
  100. 51
  101. Pei, Z., Yang, L., Williamson, J. R. (1996) Phospholipase C-{gamma} 1 binds to actin-cytoskeleton via its C-terminal SH2 domain in vitro Biochem. Biophys. Res. Commun. 228,802-806[Medline]
  102. 52
  103. Banno, Y., Nakashima, S., Ohzawa, M., Nozawa, Y. (1996) Differential translocation of phospholipase C isozymes to integrin-mediated cytoskeletal complexes in thrombin-stimulated human platelets J. Biol. Chem. 271,14989-14994[Abstract/Free Full Text]
  104. 53
  105. Yu, H., Fukami, K., Itoh, T., Takenawa, T. (1998) Phosphorylation of phospholipase C{gamma}1 on tyrosine residue 783 by platelet-derived growth factor regulates reorganization of the cytoskeleton Exp. Cell Res. 243,113-122[Medline]
  106. 54
  107. Nieto, M., Frade, J. M., Sancho, D., Mellado, M., Martinez-A, C., Sanchez-Madrid, F. (1997) Polarization of chemokine receptors to the leading edge during lymphocyte chemotaxis J. Exp. Med. 186,153-158[Abstract/Free Full Text]
  108. 55
  109. Sanchez-Madrid, F., del Pozo, M. A. (1999) Leukocyte polarization in cell migration and immune interactions EMBO J 18,501-511[Medline]
  110. 56
  111. Theriot, J. A., Mitchison, T. J. (1991) Actin microfilament dynamics in locomoting cells Nature 352,126-131[Medline]



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
V. Govindaraju, J. G. Martin, K. Maghni, P. Ferraro, and M.-C. Michoud
The Effects of Extracellular Purines and Pyrimidines on Human Airway Smooth Muscle Cells
J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 941 - 948.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. H. Han, J. Ryu, K. H. Hong, J. Ko, Y. K. Pak, J.-B. Kim, S. W. Park, and J. J. Kim
HMG-CoA Reductase Inhibition Reduces Monocyte CC Chemokine Receptor 2 Expression and Monocyte Chemoattractant Protein-1-Mediated Monocyte Recruitment In Vivo
Circulation, March 22, 2005; 111(11): 1439 - 1447.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J.-W. Ryu, K. H. Hong, J. H. Maeng, J.-B. Kim, J. Ko, J. Y. Park, K.-U. Lee, M. K. Hong, S. W. Park, Y. H. Kim, et al.
Overexpression of Uncoupling Protein 2 in THP1 Monocytes Inhibits {beta}2 Integrin-Mediated Firm Adhesion and Transendothelial Migration
Arterioscler. Thromb. Vasc. Biol., May 1, 2004; 24(5): 864 - 870.
[Abstract] [Full Text]


Home page
Innate ImmunityHome page
A.-S. W. Moller, R. Ovstebo, A.-B. Westvik, G. B. Joo, K.-B. F. Haug, and P. Kierulf
Effects of bacterial cell wall components (PAMPs) on the expression of monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1{alpha} (MIP-1{alpha}) and the chemokine receptor CCR2 by purified human blood monocytes
Innate Immunity, December 1, 2003; 9(6): 349 - 360.
[Abstract] [PDF]


Home page
BloodHome page
L. Fantuzzi, F. Spadaro, G. Vallanti, I. Canini, C. Ramoni, E. Vicenzi, F. Belardelli, G. Poli, and S. Gessani
Endogenous CCL2 (monocyte chemotactic protein-1) modulates human immunodeficiency virus type-1 replication and affects cytoskeleton organization in human monocyte-derived macrophages
Blood, October 1, 2003; 102(7): 2334 - 2337.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kito, K.
Right arrow Articles by Nishida, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kito, K.
Right arrow Articles by Nishida, K.