Journal of Leukocyte Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, K.
Right arrow Articles by Yamanaka, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, K.
Right arrow Articles by Yamanaka, H.
(Journal of Leukocyte Biology. 2001;69:531-537.)
© 2001 by Society for Leukocyte Biology

NK cell-mediated anti-tumor immune response to human prostate cancer cell, PC-3: immunogene therapy using a highly secretable form of interleukin-15 gene transfer

Kazuhiro Suzuki, Haruki Nakazato, Hiroshi Matsui, Masaru Hasumi, Yasuhiro Shibata, Kazuto Ito, Yoshitatsu Fukabori, Kohei Kurokawa and Hidetoshi Yamanaka

Department of Urology, Gunma University School of Medicine, Maebashi, Japan

Correspondence: Kazuhiro Suzuki, M.D., Department of Urology, Gunma University School of Medicine, 3-39-22, Showa-machi, Maebashi, 371-8511, Japan. E-mail: kazu{at}showa.gunma-u.ac.jp


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Interleukin (IL)-15 is a pleiotropic cytokine that is important for innate and adaptive immune cell homeostasis. The expression of IL-15 protein is controlled by posttranscriptional mechanisms. Here, we constructed a human IL-15 expression vector consisting of the human IL-2 signal peptide, the human IL-15 mature peptide-coding sequences, and an out-of-frame human growth hormone gene. Human prostate cancer cells, PC-3, transfected with this highly secretable form of the IL-15 gene, successfully secreted abundant bioactive IL-15 protein. In nude mice, the growth of PC-3 cells producing IL-15 was remarkably retarded. NK cell-depletion using anti-asialo GM1 antibody restored tumorigenicity. Histologically, tumors derived from IL-15-producing PC-3 cells contained necrotic areas with high apoptotic index. Splenocytes incubated with supernatant of transfectants killed target PC-3 cells and expressed a significantly high level of mIFN-{gamma} mRNA. These observations suggest that NK cell-mediated, anti-tumor effects of IL-15 could provide a potential rationale for gene therapy of prostate cancer.

Key Words: cellular immunity • chimeric peptide • murine IFN • anti-asialo GM1


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prostate cancer is the most common malignant tumor in men and the second leading cause of cancer death in the United States [1 ]. Although the incidence of prostate cancer in Japan is lower than that in the United States, it is increasing year by year [2 ]. In early stage prostate cancer, radiation therapy and surgical therapy are potentially curative treatment modalities. In patients with advanced prostate cancer, hormonal ablation therapy is performed. This allows remission of the disease in >90% of patients. However, most of them encounter tumor recurrence within 1–3 years of treatment. At this stage, prostate cancer loses androgen-dependency and becomes an androgen- or hormone-independent tumor. The survival rate for hormone-independent prostate cancer is very poor [3 4 5 ]. Therefore, new treatment modalities are warranted.

Immunogene therapy is one of the promising treatment modalities for malignant tumors. The efficiency of administration of interleukin (IL)-2 to widely metastasized cancer in humans was studied in 1985 [6 ]. However, significant toxicity was observed after systemic administration of high-dose IL-2. With the progress of molecular biology, gene transfer techniques have enabled the generation of cytokine-producing tumor cells, which act as tumor vaccines. Several cytokines including IL-2 [7 ], granulocyte-macrophage colony stimulating factor [8 ], interferon (IFN)-ß [9 ], IL-10 [10 ], and IL-12 [11 ] have been used in models of prostate cancer, and anti-tumor effects were observed.

IL-15 is a pleiotropic cytokine that acts upon innate and adaptive immune cells [12 ]. IL-15 shares many functions with IL-2, using the IL-2/15 receptor beta and the common gamma-chain for signaling [13 14 15 ]. However, IL-15 uses a unique IL-15 receptor alpha for high-affinity binding [16 ]. The biological functions of IL-15 vary widely and include a critical role in the development, survival, and function of the natural killer (NK) cell lineage and the normal expansion of memory CD8 T cell lineage [17 18 19 20 21 22 23 ]. Further, IL-15 is important in T-lymphocyte trafficking [24 ], innate immune IFN-{gamma} production [25 ], and host defense against infectious pathogens [12 ].

Expecting NK cell and T cell immune responses of IL-15, an immunogene therapy model for murine fibrosarcoma, Meth A, was described [26 , 27 ]. Tumor cells engineered to secrete IL-15 augmented anti-tumor immune responses in normal mice; however, there was no drastic effect in nude mice. The authors concluded that the anti-tumor effects were mediated by local and systemic T cell-dependent immunity. In many malignant tumor cells, including prostate cancer, immunogenicity is repressed frequently by the down-regulation of major histocompatibility complex (MHC)-I and -II expression levels [28 , 29 ]. NK cells participate in the innate immune response and do not require MHC for antigen presentation [30 ]. Therefore, NK cell-mediated, anti-tumor immune responses would be of great potential benefit to immunogene therapy for malignant tumors.

IL-15, which has a critical role in NK cell development and function, has three primary posttranscriptional checkpoints for its translation and secretion. These include nonfunctional AUGs in the 5' untranslated region [13 , 31 , 32 ], poorly secreted (both long and short) signal peptides (SPs) [33 34 35 ], and a negative regulator near the C-terminus of the precursor protein [35 ]. In the current study, we disrupted these checkpoints and engineered a highly secretable form of the IL-15 gene. Human prostate cancer cells, PC-3, transfected with this gene, successfully secreted IL-15 protein and were rejected in nude mice. Depletion of NK cells abrogated this anti-tumor effect completely. Therefore, using a highly secretable form of the IL-15 gene could enable immunogene therapy targeting of PC-3 through NK cell-mediated, anti-tumor immunity.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cells
PC-3 were purchased from Dainippon Pharmaceutical (Tokyo, Japan) and were maintained in F-12K (Gibco BRL, Rockville, MD), supplemented with 7% fetal calf serum (FCS; Moregate, Bulimba, Australia) and antibiotics/antimycotics (Gibco BRL). IL-2-dependent, murine T-lymphoblast cells, CTLL-2, were purchased from Health Science Research Resources Bank (Osaka, Japan) and cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FCS, 10 mM HEPES, 1.6 mM L-glutamine, 1.2 mM L-asparagine, 0.55 mM L-arginine, 14 µM folic acid, 50 µM 2-mercaptoethanol, and recombinant human (rh)IL-2 (100 U/ml; Gibco BRL).

RNA extraction and conventional reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was extracted from human peripheral blood lymphocyte (PBL), human renal tissue, PC-3, or splenic cells by the guanosine isothiocyanate method using RNeasy kits (Qiagen, Valencia, CA). Total RNA (0.5–2 µg) was reverse-transcribed by random primer (Gibco RBL) according to the manufacture’s protocol. Each cDNA sample (5 µl) was used as a template for a PCR reaction, which was performed according to the method described by Fehniger et al. [36 ]. Reaction mixtures were subjected to the following scheme: one cycle at 95°C for 10 min and 35 cycles at 94°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec. PCR products were electorphoresed on a 2% agarose gel, stained with ethidium bromide, and visualized by UV fluorescence.

Construction of hIL-15 expression vector
The hIL-2 SP coding sequence (nt 48–107, GenBank V00564) was PCR-amplified from human PBL cDNA with a forward primer (5'-aggtgcactgtttgtgacaagt-3') and a reverse primer (5'-tgccagaatgtacaggatgc-3'). The hIL-15 mature peptide (MP) coding sequence (nt 461–802, GenBank U14407) was PCR-amplified from human renal cDNA with a forward primer (5'-gaagccaactgggtgaatgt-3') and a reverse primer (5'-tgccgagtgttttgttatgtc-3'). Both PCR products were TA-cloned into the PCR 2.1 vectors (Invitrogen, San Diego, CA), and sequences were confirmed (ABI PRISM 310, PE Applied Biosystems, Foster City, CA). Nar I endonuclease restriction site (underlined) was engineered in the 3' of IL-2 SP and 5' of IL-15 coding sequences by designing a reverse primer for IL-2 SP (5'-atcggcgcctgcactgtttgtgacaagtgc-3') and a forward primer for IL-15 MP (5'-gatggcgccaactgggtgaatgtaataagtg-3'). The BamHI endonuclease restriction site (underlined) and FLAG epitope tag (italic) were engineered by designing a reverse primer for IL-15 MP (5'-gatcggatccctatttgtcatcgtcgtccttgtagtcagaagtgttgatgaa-3'). The EcoRI/NarI fragment of the IL-2 SP coding sequence and the NarI/BamHI fragment of the IL-15 coding sequence with a FLAG epitope were triple-ligated into pUC18 (Stratagene, San Diego, CA) using EcoRI/BamHI sites. Next, the BamHI/EcoRI fragment of the human growth hormone (hGH) gene [37 ] was triple-ligated into the EcoRI site of pUC18 with the EcoRI/BamHI fragment of chimeric coding DNA consisting of the IL-2 SP and IL-15 MP. Finally, the resultant EcoRI fragment containing IL-2 SP/IL-15 MP/hGH was ligated into pCI-neo (Promega, Madison, MI), pCI/IL-15.

DNA transfection, selection of clones, and harvest of supernatant
The day before transfection, 2 x 105 PC-3 cells were plated into six-well plates. pCI/IL-15 (2 µg) or pCI-neo (mock) was transfected by the lipofection method using TransIT-LT1 (Mirus, Madison, WI) following the manufacture’s protocol. Transfectants were selected in F-12K, supplemented with 7% FCS, antibiotics/antimycotics, and 0.8 mg/ml G418 (Gibco RBL). G418-resistant clones were isolated and expanded in culture medium containing 0.4 mg/ml G418. To harvest supernatant for further analysis, cells (2x105) were incubated with culture media without G418 for 24 h.

Quantitative real-time PCR
Chimeric IL-2 SP/IL-15 MP cDNA and murine (m)IFN-{gamma} transcripts were quantified by dual-labeled fluorogenic probes, using a Prism 7700 thermal cycler and sequence detector (PE Applied Biosystems) according to the method described by Fehniger et al. [36 ]. The primers used were IL-15, forward: 5'-cgacgatgacaaatagggatcc-3', reverse: 5'gacgtccgggagcctgta-3', probe: 5'-FAM aactccccgaaccactcagggtcct TAMRA-3'; mIFN-{gamma}, forward: 5'-agcaacagcaaggcgaaaa-3', reverse: 5'-ctggacctgtgggttgttga-3', probe: 5'-FAM cctcaaacttggcaatactcatgaatgcatcc TAMRA-3'; 18S rRNA, forward: 5'cggctaccacatccaaggaa-3', reverse: 5'gctggaattaccgcggct-3', probe: 5'-FAM tgctggcaccagacttgccctc TAMRA-3'. In parallel with experimental samples, standard curves for chimeric IL-15, mIFN-{gamma}, and 18S rRNA (reference control) of known concentrations were quantified, and absolute copy numbers were calculated. PCR products of chimeric IL-15, mIFN-{gamma}, and 18S rRNA were TA-cloned into pCR2.1, and sequences were confirmed using ABI PRISM 310. Obtained vectors were used for standard curve generation.

IL-15 bioassay
Supernatants from pCI/IL-15-transfected PC-3 and mock-transfected PC-3 were used for 3-(4,5-dimethylthiazol-2 yl)-2,5-diphenyl tetrazolium bromide (MTT; Sigma, St. Louis, MO) bioassay to measure the IL-15 bioactivity. CTLL-2 cells (1x105/well) were incubated with 50 µl culture medium (CM) with 50 µl supernatants for 20 h at 37°C in 5% CO2 atmosphere followed by a 4-h pulse with 50 µg MTT. In parallel with the experiments, known amounts of rhIL-15 (PeproTech, London, England) were added to CTLL-2 cells to generate a standard curve. Isopropanol with 0.04 N hydrochloric acid (100 µl) was added to lyse cells. Color development at 540 nm was measured by an enzyme-linked immunosorbent assay reader, Microplate Readers SOFTmax-J (Molecular Devices, Sunnyvale, CA).

In vitro proliferation of transfectants
pCI/IL-15-transfected PC-3 cells or mock-transfected PC-3 cells (2x104) were plated into 24-well plates. After 24 h, the number of viable cells was determined by vital dye exclusion with trypan blue.

Animal studies
Six-week-old male BALB/c nu/nu mice were purchased from Japan SCL (Hamamatsu, Japan). PC-3/IL-15 or mock-transfected PC-3 cells (1x106) were injected subcutaneously in the right lower abdominal quadrant via a 21-gauge needle. Tumor volumes were measured in mm3 with a vernier caliper and determined according the following formula: a x b2 x 0.5, where a is the larger, and b is the smaller of the two dimensions. In another study, PC-3/IL-15 cells (1x106) were injected subcutaneously again, and mice were also treated with anti-asialo GM1 antibody (200 µg/mice, intraperitoneal; Wako Pure Chemical, Osaka, Japan) on the day before tumor inoculation and every 7th day thereafter. Tumor volumes were measured in the same manner as described above. The animals were treated in compliance with institutional guidelines.

Histological examination and TUNEL labeling
Mice were sacrificed, and subcutaneous tumors were dissected out at 7 weeks after tumor-cell inoculation. Tumors were fixed in 10% neutral-buffered formalin for 24 h and embedded in paraffin. Sections of 5 µm were stained with hematoxylin and eosin.

Apoptotic cells were labeled by the TUNEL method (terminal deoxynucleotidyl transferase-mediated dUTP nick and labeling) using TACS 2 TdT-DAB In Situ Apoptosis Detection Kit (Travigen, Gaithersburg, MD) following the manufacture’s recommendation. Labeling was performed with the presence of Co2+ for 1 h at 37°C. Labeled cells were detected by a streptavidin-horseradish peroxidase-diaminobentidine reaction. Nuclei were counterstained with methylgreen. The apoptotic index was determined by counting the number of apoptotic cells per 1000 tumor cells.

Spleen cell-mediated cyotoxicity
Splenocytes from male BALB/c nu/nu (2x106) were incubated in 5 ml CM with 5 ml supernatant from PC-3/IL-15 or mock-transfected PC-3 cells. CM and supernatants were exchanged every 3 days, and cells were cultured for 7 days.

Cytotoxic assay was performed according to the method of Dong et al. [9 ]. PC-3 cells (1x106) were labeled with [3H]-thymidine (NEM Life Science Products, Boston, MA) with a specific activity of 6.7 Ci/mmol. Preincubated splenic cells were incubated with thymidine-labeled PC-3 cells (1x104/well) in 96-well plates for 6 h with various effector/target ratios. After a brief spin, 100 µl culture supernatants were harvested, and radioactivity was counted in a liquid scintillation counter. The specific cytolytic activity of the splenic cells was calculated as follows: cytolysis (%) = (A-B)/(T-B) x 100, where A = cpm in cultures of splenic cells and target cells, B = cpm in cultures of target cells only, and T = total cpm of target cells added into each well.

Statistical analysis
The results obtained from multiple experiments were expressed as mean ± SD. Statistical significance among groups was determined by the Student’s t-test, with p < 0.05 considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
PC-3 transfected with chimeric IL-2 SP/IL-15 MP coding cDNA successfully express chimeric IL-15 and secrete bioactive IL-15 protein
Translation and secretion of IL-15 are strictly regulated at the posttranscriptional levels [31 ]. We constructed a chimeric IL-15 cDNA in which wild type IL-15 SP was exchanged for that of the easily secreted cytokine IL-2. At the 3' of IL-15 MP, a FLAG epitope tag was added to stabilize the c-terminus of the mature IL-15 protein. An out-of-frame hGH gene was spliced downstream of the IL-15-coding cDNA to maximize transcription, translation, and processing of the transfected IL-15 cDNA [38 ] (Fig. 1 ).



View larger version (15K):
[in this window]
[in a new window]
  		Figure 1. Structure of chimeric hIL-2 SP/hIL-15 MP expression vector. The coding DNA of hIL-2 SP and hIL-15 MP was fused with a Nar I restriction site. The FLAG tag sequence was added between the last codon of the IL-15 mature protein and stop codon. hGH gene (exon 1–3' UTR) was fused at the 3' of the stop codon. This chimeric cDNA was driven by the CMV promoter.

 
PC-3 was transfected with pCI/IL-15, and G418-resistant clones were selected. First, screening of positive clones was performed by RT-PCR. The forward primer sits at FLAG epitope, and the reverse primer sits at the splicing junction of exon 1 and exon 2 of the hGH gene. Although, the length of hGH gene intron 1 is very short (257 bp), the specific chimeric IL-15 transcript (100 bp) was amplified exclusively by RT-PCR by designing the reverse primer at the splicing junction (Fig. 2A ). These primers do not recognize the coding sequence of endogenous IL-15. Therefore, the transcript of chimeric IL-15 was differentiated completely from the endogenous IL-15 transcript or the transcript derived from genomic DNA contamination. Chimeric IL-15 expression levels were quantified by real-time PCR. The clone PC-3/IL-15-1 was found to express the highest copy number (Fig. 2B) . To measure the bioactivity of IL-15 in supernatants from transfectants, we performed CTLL-2 proliferation bioassays. rhIL-15 stimulates IL-2-dependent CTLL-2 cells as shown in Figure 3 . Supernatants from PC-3/IL-15-1 and PC-3/IL-15-2 demonstrated high bioactivities in the range of ng/ml. From these observations, PC-3 transfected with chimeric IL-2 SP/IL-15 MP coding cDNA was demonstrated to express the chimeric IL-15 gene successfully and secrete the bioactive IL-15 protein.



View larger version (22K):
[in this window]
[in a new window]
  		Figure 2. Chimeric IL-15 gene transcript detection. (A) Specific chimeric IL-15 transcript was amplified from cDNA of PC-3/IL-15-1 (lane 1). From the genomic DNA from PC-3/IL-15-1, no specific band was detected (lane 2). (B) Quantitative real-time PCR of RT-PCR-positive clones and mock-transfected PC-3 cells. Results show chimeric IL-15 transcript copy number normalized by a 106 18S rRNA copy number.

 


View larger version (17K):
[in this window]
[in a new window]
  		Figure 3. CTLL-2 proliferation assay. IL-2-dependent CTLL-2 cells (1x105) were incubated with known amounts of rhIL-15 or supernatants of transfectants for 20 h followed by MTT pulse for 4 h. PC-3/IL-15-1 secretes the most abundant bioactive IL-15 protein.

 
IL-15 gene-transfected PC-3 can proliferate as mock-transfected PC-3 cells in vitro
Because the PC-3/IL-15-1 clone expressed and secreted the most abundant bioactive IL-15, we used this clone for further experiments. To check the proliferation of this clone in vitro, we counted cell number using vital dye exclusion to detect viable cells. As shown in Figure 4 , PC-3/IL-15-1 cells can proliferate in a similar manner as mock-transfected PC-3 cells in vitro.



View larger version (12K):
[in this window]
[in a new window]
  		Figure 4. In vitro proliferation of chimeric IL-15 gene-transferred PC-3 cells. PC-3/IL-15-1 or PC-3/mock cells (2x104) were incubated in normal culture media. Tripan blue excluding viable cells was counted every 24 h. Results are mean ± SD from three independent experiments.

 
Chimeric IL-15 gene-transfected PC-3 cells were rejected in nude mice
To investigate the host-tumor interaction in vivo, PC-3/IL-15-1 (1x106) or control PC-3/mock cells were injected subcutaneously into nude mice, which lack T cells. In PC-3/mock-inoculated animals, tumors started to grow 1 week after inoculation and enlarged markedly after 3 weeks. By contrast, animals injected with PC-3/IL-15-1 cells developed very small tumors, and some tumors were completely rejected (Fig. 5A ).



View larger version (14K):
[in this window]
[in a new window]
  		Figure 5. In vivo tumorigenicity of chimeric IL-15 gene-transfected PC-3 cells. (A) BALB/c nude mice were inoculated subcutaneously with 1 x 106 chimeric IL-15 gene transfectants (PC-3/IL-15-1) or mock-transfectant (PC-3/mock). After 7 weeks of inoculation, a significant difference was observed in tumor volumes (P=0.001). (B) The effect of NK cell depletion. PC-3/IL-15-1 (1x106) cells were inoculated subcutaneously to BALB/c nude mice with or without anti-asilo GM1 antibody. Anti-asialo GM1 antibody (200 µg) was injected intraperitoneally on the day before tumor-cell inoculation and every 7 days thereafter. After 7 weeks of inoculation, a significant difference was observed in tumor volumes (P<0.05).

 
Microscopically, PC-3/mock tumors were encapsulated by fibrous tissue. At this area, a small number of mononuclear cells were detected. The tumor cells had a relatively large nucleus with prominent nucleolus (Fig. 6A ). PC-3/IL-15-1 tumors also had fibrous capsules, and mononuclear cell invasions were seen at the fibrous capsules and perivascular regions in the tumor (Fig. 6B) . In addition, several PC-3/IL-15-1 tumors contained necrotic regions or cells with nuclear condensation (Fig. 6C) .



View larger version (215K):
[in this window]
[in a new window]
  		Figure 6. Histopathological findings of subcutaneous tumors originated from chimeric IL-15 gene-transfected PC-3 (PC-3/IL-15-1) or mock-transfectant (PC-3/mock); original magnification x100. Tumors were dissected out at 7 weeks after inoculation, fixed in 10% neutral-buffered formalin for 24 h, and embedded in paraffin. Sections of 5 µm were stained with hematoxylin and eosin. (A) PC-3/mock in BALB/c nude mice. Tumor cells have large nuclei and prominent nucleoli. The peripheral fibrous capsule contains mononuclear cells. (B) PC-3/IL-15-1 in BALB/c nude mice. The subcutaneous tumor and peripheral fibrous capsule contain massive mononuclear cell invasion. (C) PC-3/IL-15-1 in BALB/c nude mice. Tumor contains necortic area (arrow) and nuclear condensation (arrow heads). (D) PC-3/IL-15-1 in BALB/c nude mice treated with anti-asialo GM1 antibody. No necrotic areas were observed. Histological findings were similar to those of tumors from mock-transfectant.

 
To examine the effects of NK cells on the development of tumors in this model, nude mice, which lack T cells, were depleted of NK cells using anti-asialo GM1 antibody. These NK-deficient mice were then injected with PC-3/IL-15-1 cells. Tumors in animals not treated with anti-asialo GM1 antibody were very small or rejected, consistent with the previous experiment. However, NK-depleted mice were susceptible to tumorigenesis as shown in Figure 5B . Histological findings of the tumors from NK-depleted mice were similar to those of mock-transfected mice (Fig. 6D) .

To investigate whether the inhibition of tumor growth in PC-3/IL-15-1 tumors was associated with apoptosis, TUNEL staining was performed (Fig. 7 ). In tumors of mock-transfected PC-3, the labeling index was about 2.5. Tumors of PC-3/IL-15-1 showed a significantly higher labeling index. In anti-asialo GM1 antibody-treated mice, the labeling index showed no difference compared with PC-3/mock-transfected tumors.



View larger version (11K):
[in this window]
[in a new window]
  		Figure 7. TUNEL labeling index. Apoptotic cells were stained by the TUNEL method. Results were mean ± SD from five samples. Labeling indexes were calculated as positive cell number per 1000 cells. PC-3/IL-15-1 without anti-asialo GM1 antibody treatment showed a significantly higher rate (P<0.05).

 
Splenic cells treated with PC-3/IL-15-1 supernatant kill PC-3 cells and express higher levels of mIFN-{gamma} transcript
To investigate underlying mechanisms of tumorigenicity suppression in our model, we first investigated the cytotoxicity of splenic cells. Splenocytes harvested from normal nude mice were incubated with supernatant from PC-3/mock or PC-3/IL-15-1 cells for 7 days. Spleen cells incubated with control supernatants did not lyse PC-3 cells. However, spleen cells incubated with IL-15/PC-3-1-cell supernatant had the ability to kill target PC-3 cells (Fig. 8A ). We next examined mIFN-{gamma} transcript expression levels of these splenic cells. Spleen cells incubated with PC-3/IL-15-1 supernatant expressed sixfold higher levels of mIFN-{gamma} compared with control target cells (Fig. 8B) .



View larger version (10K):
[in this window]
[in a new window]
  		Figure 8. Splenic cell-mediated tumor killling of PC-3 cells and mIFN-{gamma} gene expression levels of splenic cells. (A) Cytotoxicity of splenic cells incubated with supernatant of PC-3/IL-15-1 or PC-3/mock. Splenic cells from BALB/c nude mice were incubated with each supernatant for 7 days. Cytotoxicity of these cells against PC-3 cell targets was measured. Results were mean ± SD from three independent experiments. (B) mIFN-{gamma} gene expression levels of splenic cells incubated with the supernatant of PC-3/IL-15-1 or PC-3/mock. Splenic cells incubated with these supernatants were harvested, and total RNA was extracted. mIFN-{gamma} gene expression levels were quantified by real-time RT-PCR. Results were mean ± SD from three independent experiments. (*) Value was significantly higher (P<0.05).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we demonstrate the suppression of tumorigenesis of PC-3 cells transfected with a chimeric IL-15 gene in nude mice. It is interesting that depletion of NK cells inhibited this effect. Therefore, we hypothesize that NK cells mediate the anti-tumor effect of IL-15 on PC-3 tumor cell growth.

In a previous study using murine fibrosarcoma cell line, Meth A, IL-15 gene-transfected Meth A cells were rejected in normal mice [26 , 27 ]. However, nude mice and mice with CD4+ T cell depletion did not reject these tumors producing IL-15. The authors concluded that CD4+ T cells were the key player in the anti-tumor effect of IL-15 in this model. In contrast, Di Carlo et al. [39 ] showed that small cell-lung cancer (SCLC) cells engineered to secret IL-15 protein were rejected in nude mice, suggesting the importance of NK cells for the observed anti-tumor effect. The differences in results could, in part, be explained by the different properties of the cell lines. However, we would expect that these differences could be attributed to the unique biologic properties of IL-15, which is a pleiotropic cytokine and important in lymphocyte homeostasis [12 ]. IL-15 mRNA is expressed by most tissues [13 ], but IL-15 protein can rarely be detected except in supernatants of CV1/EBNA cells [13 ] and human T cell lymphotropic virus (HTLV)-infected T cells [40 ]. IL-15 has multiple posttranscriptional checkpoints [31 ] including multiple AUGs in the 5'-untranslated region (UTR) [13 , 31 , 32 ], unusually long and short SPs [33 , 34 ], and a negative regulator near the C-terminus of the precursor proteins [35 ]. Such tight posttranscriptional control of the IL-15 gene product is unusual for cytokine, and the exact reasons for this remain to be clarified. In the study showing the role of IL-15 on Meth A cells, the authors used the endogenous IL-15 SPs [26 , 27 ], and they found a very small amount of IL-15 protein only in the supernatants or cell lysates. These findings are compatible with the observation that IL-15 protein may be associated with cell membrane after translation [41 ]. However, the exchange of the endogenous SP for that of secretory protein, such as IL-2 [35 ], immunoglobulin (Ig) [42 ], or CD33 [43 ], contributes to efficient secretion of bioactive IL-15 protein. As we show in our model using the hIL-2 SP and in Di Carlo’s model [39 ] using Ig {kappa} SP [38 ], abundant IL-15 protein can be detected in supernatants using chimeric cDNA consisting of coding sequences of a SP from a secretory protein and the IL-15 MP. In the current study, we have eliminated all three posttranscriptional checkpoints and added the hGH gene to maximize transcription, translation, and processing of the transfected IL-15 cDNA. This full modification of the IL-15 expression cassette results in 5–10 ng/ml IL-15 protein from 2 x 105 cells.

In vitro, IL-15 has a critical role in the development, survival, and function of NK cells [17 18 19 20 21 ]. IL-15-/- mice are NK cell-deficient [23 ], and the exogenous administration of rhIL-15 to IL-15-/- mice results in an increased number of NK cells. Furthermore, the exogenous administration of rhIL-15 leads to increased NK cells in normal mice [44 ]. However, transgenic mice engineered to overexpress IL-15 with the endogenous SP did not show an NK cell expansion [45 ]. These observations would suggest that exogenous or engineered secretory IL-15 could influence NK cells directly in vivo. Therefore, our fully modified IL-15 expression vector resulted in abundant, secreted IL-15 protein and was optimal for this human PC-3 prostate cancer xenograft model.

The mechanism underlying the anti-tumor effects mediated by NK cells in our model could, in part, be explained by the increased IFN-{gamma} transcript and cytotoxicity of splenocytes. This observation is consistent with previous data describing the effects of IL-15 on NK cell function [46 ]. Histopathologically, subcutaneous tumors from PC-3 cells engineered to overexpress IL-15 contained necrotic regions or nuclear condensation. The TUNEL labeling index was significantly higher in this tumor. It is interesting that we did not observe an elevation in IFN-{gamma} transcript or cytotoxicity against PC-3 cells in splenocytes from nude mice injected with PC-3/IL-15-1 (unpublished results) nor did these mice exhibit any abnormal findings, including an increase in peripheral white blood cell (WBC) number (unpublished results). Therefore, we speculate that IL-15 secreted from PC-3 cells acts locally on immune cells.

Previous studies have suggested that IL-15 is important in the antigen-independent maintenance of the memory CD8 T cell pool [22 , 23 , 45 , 46 ]. IL-15 also has an anti-tumor effect on Meth A cells through CD4+ T cells [26 , 27 ]. As for asialo GM1, it is not entirely specific for NK cells, and other cells, such as macrophage/monocyte, might be depleted partially by anti-asialo GM1 antibody administration. Therefore, anti-tumor effects observed in our study could, in part, be explained by the effects of these cells. A murine model of prostate cancer would provide the opportunity for further investigation of the potential role of IL-15-mediated anti-tumor effects in this cancer. Recently, a murine transgenic prostate cancer model (TRAMP) was developed [47 48 49 ]. Currently, we are investigating the role of IL-15 in this model.

In summary, we have demonstrated the anti-tumor effects of IL-15 on PC-3 in nude mice. This novel observation could provide one promising rationale for the immunogene therapy of prostate cancer. IL-15 could be a potential candidate for tumor vaccine or adenoviral vector-mediated gene therapy.


   ACKNOWLEDGEMENTS
 
This work was supported in part by a Grand-in-Aid from the Ministry of Education, Science, Sports and Culture of Japan (Project No. 12877251-00).

Received September 29, 2000; revised November 27, 2000; accepted November 28, 2000.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Landis, S. H., Murray, T., Bolden, S., Wingo, P. A. (1998) Cancer statistics CA - Cancer J. Clin. 48,6-29[Abstract]
  2. Kuroishi, T. (2000) International comparison of prostate cancer incidence and morbidity Nihon Rinsho 58 Suppl,12-21
  3. Haas, G. P., Pontes, J. E. (1995) Management of the urological patient Sivak, E. eds. The High Risk Patient: Management of the Critically Ill Patient ,839-856 Lea and Febiger Philadelphia, PA.
  4. Redman, G. B., Pienta, K. J. (1995) New treatment strategies for hormone refractory prostate cancer Semin. Urol. 2,164-169
  5. Flanigan, R. C., Shankey, T. V. (1992) The natural history of human prostate cancer D. Raghavan, D. Scher, H. I. Leibel, S. A. Lange, P. eds. Principles of Genitourinary Oncology ,443-450 Lippincott Williams & Wilkins Philadelphia, PA.
  6. Rosenberg, S. A., Mule, J. J., Spiess, P. J., Reichert, C. M., Shwartz, S. L. (1985) Regression of established pulmonary metastases and subcutaneous tumor mediated by the systemic administration of high-dose recombinant IL-2 J. Exp. Med. 161,1169-1188[Abstract/Free Full Text]
  7. Moody, D. B., Robinson, J. C., Ewing, C. M., Lazenby, A. J., Isaacs, W. B. (1994) Interleukin-2 transfected prostate cancer cells generate a local antitumor effect in vivo Prostate 24,244-251[Medline]
  8. Simons, J. W., Mikhak, B. (1998) Ex-vivo gene therapy using cytokine-transduced tumor vaccines: molecular and clinical pharmacology Semin. Oncol. 25,661-676[Medline]
  9. Dong, Z., Greene, G., Pettaway, C., Dinney, P. N., Eue, I., Lu, W., Bucana, C. D., Balbay, M. D., Bielengerg, D., Fidler, I. J. (1999) Suppression of angiogenesis, tumorigenesis, and metastasis by human prostate cancer cells engineered to produce interferon-ß Cancer Res 59,872-879[Abstract/Free Full Text]
  10. Stearns, M. E., Garcia, F. U., Fudge, K., Rhim, J., Wang, M. (1999) Role of interleukin 10 and transforming growth factor beta1 in the anigiogenesis and metastasis of human prostate primary tumor lines from orthotopic implants in severe combined immunodeficiency mice Clin. Cancer Res. 5,711-720[Abstract/Free Full Text]
  11. Nasu, Y., Bangma, C. H., Hull, G. W., Lee, H. M., Wang, H. J., McCurdy, M. A., Shimura, S., Yang, G., Timme, T. L., Thompson, T. C. (1999) Adenovirus-mediated interleukin-12 gene therapy for prostate cancer: suppression of orthotopic tumor growth and pre-established lung metastases in an orthotopic model Gene Ther 6,338-349[Medline]
  12. Waldmann, T. A., Tagaya, Y. (1999) The multifaceted regulation of interleukin-15 expression and the role of this cytokine in NK cell differentiation and host response to intracellular pathogen Annu. Rev. Immunol. 17,19-49[Medline]
  13. Grabstein, K. H., Eisenman, J., Shanebeck, K., Rauch, C., Srinivasan, S., Fung, V., Beers, C., Richardson, J., Shoenborn, A., Ahdieh, M., et al (1994) Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor Science 264,965-968[Abstract/Free Full Text]
  14. Giri, J. G., Ahdieh, J., Eisenman, K., Shanebeck, K., Grabstein, K., Kumaki, S., Namen, A., Park, L. S., Cosman, D., Anderson, D. (1995) Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15 EMBO J 13,2822-2830[Medline]
  15. Carson, W. E., Giri, J. G., Lindermann, M. J., Linett, M. L., Ahdieh, M., Paxton, R., Anderson, D., Eisenman, J., Grabstein, K., Caligiuri, M. A. (1994) Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor J. Exp. Med. 180,1395-1403[Abstract/Free Full Text]
  16. Giri, J. G., Kumaki, S., Ahdieh, M., Friend, D. J., Loomis, A., Shanebeck, K., DuBose, R., Cosman, D., Park, L. S., Anderson, D. M. (1995) Identification and cloning of a novel IL-15 binding protein that is structurally related to the a chain of the IL-2 receptor EMBO J 14,3654-3663[Medline]
  17. Mrozek, E., Anderson, P., Caligiuri, M. A. (1996) Role of interleukin-15 in the development of human CD56+ natural killer cells from CD34+ hematopoietic progenitor cells Blood 87,2632-2640[Abstract/Free Full Text]
  18. Carson, W. E., Fehniger, T. A., Haldar, S., Eckhert, K., Lindemann, M. J., Lai, C. F., Croce, C. M., Baumann, H., Caligiuri, M. A. (1997) A potential role for interleukin-15 in the regulation of human natural killer cell survival J. Clin. Invest. 99,937-943[Medline]
  19. Ogasawara, K., Hida, S., Azimi, N., Tagaya, Y., Sato, T., Yokochi-Fukuda, T., Waldmann, T. A., Taniguchi, T., Taki, S. (1998) Requirement for IRF-1 in the microenvironment supporting development of natural killer cells Nature 391,700-703[Medline]
  20. Ohteki, T., Yoshida, H., Matsuyama, T., Duncan, G. S., Mak, T. W., Ohashi, P. S. (1998) The transcription factor interferon regulatory factor 1 (IRF-1) is important during the maturation of natural killer 1.1+ T cell receptor-alpha/beta+ (NK1+ T) cells, natural killer cells, and intestinal intraepithelial T cells J. Exp. Med. 187,962-972
  21. Lodolce, J. P., Boone, D. L., Chai, S., Swain, R. E., Dassopoulos, T., Trettin, S., Ma, A. (1998) IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation Immunity 9,669-676[Medline]
  22. Zhang, X., Sun, S., Hwang, I., Tough, D. F., Sprent, J. (1998) Potent and selective stimulation of memory-phenotype CD8+ T cells in vivo by IL-15 Immunity 8,591-599[Medline]
  23. Kennedy, M. K., Glaccum, M., Brown, S. N., Butz, E. A., Viney, J. L., Embers, M., Matsuki, N., Charrier, K., Sedger, L., Willis, C. R., Brasel, K., Morrissey, P. J., Stocking, K., Schuh, J. C. L., Joyce, S., Peschon, J. J. (2000) Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice J. Exp. Med. 191,771-780[Abstract/Free Full Text]
  24. Wilkinson, P. C., Liew, F. Y. (1995) Chemoattraction of human blood T lymphocytes by interleukin-15 J. Exp. Med. 181,1255-1259[Abstract/Free Full Text]
  25. Fehniger, T. A., Yu, H., Cooper, M., Suzuki, K., Shah, M., Caligiuri, M. A. (2000) IL-15 costimulates the generalized Shwartzman reaction and innate immune IFN-{gamma} production in vivo J. Immunol. 164,1643-1647[Abstract/Free Full Text]
  26. Kumura, K., Nishimura, H., Hirose, K., Matsuguchi, T., Nimura, Y., Yoshikai, Y. (1999) Immunogene therapy of murine fibrosarcoma using IL-15 gene with high translation efficiency Eur. J. Immunol. 29,1532-1542[Medline]
  27. Hazama, S., Noma, T., Wang, F., Iizuka, N., Ogura, Y., Yoshimura, K., Inoguchi, E., Hakozaki, M., Hirose, K., Suzuki, T., Oka, M. (1999) Tumor cells engineered to secrete interleukin-15 augment anti-tumor immune responses in vivo Brit. J. Cancer 80,1420-1426[Medline]
  28. Sanda, M. G., Restifo, N. P., Walsh, J. C., Kawakami, Y., Nelson, W. G., Pardoll, D. M., Simons, J. W. (1995) Molecular characterization of defective antigen processing in human prostate cancer J. Natl. Cancer Inst. 87,280-285[Abstract/Free Full Text]
  29. Bander, N. H., Yao, D., Liu, H., Chen, Y. T., Steiner, M., Zuccaro, W., Moy, P. (1997) MHC class I and II expression in prostate carcinoma and modulation by interferon-alpha and -gamma Prostate 33,233-239[Medline]
  30. Robertson, M. J., Ritz, J. (1990) Biology and clinical relevance of human natural killer cells Blood 76,2421-2438[Free Full Text]
  31. Tagaya, Y., Bamford, R. N., DeFilippis, A. P., Waldmann, T. A. (1996) IL-15: a pleiotropic cytokine with diverse receptor/signaling pathways whose expression is controlled at multiple levels Immunity 4,329-336[Medline]
  32. Bamford, R. N., Battiata, A. P., Burton, J. D., Sharma, H., Waldmann, T. A. (1996) Interleukin (IL) 15/IL-T production by the adult T-cell leukemia cell line HuT-102 is associated with a human T-cell lymphotrophic virus type I region/IL-15 fusion message that lacks many upstream AUGs that normally attenuates IL-15 mRNA translation Proc. Natl. Acad. Sci. USA 93,2897-2902[Abstract/Free Full Text]
  33. Tagaya, Y., Kurys, G., Thies, T. A., Lose, J. M., Azimi, N., Hanover, J. A., Bamford, R. N., Waldman, T. A. (1997) Generation of secretable and nonsecretable interleukin 15 isoforms through alternate usage of signal peptides Proc. Natl. Acad. Sci. USA 94,14444-14449[Abstract/Free Full Text]
  34. Nishimura, K., Washizu, J., Nakamura, N., Enomoto, A., Yoshikai, Y. (1998) Translational efficiency is up-regulated by alternative exon in murine IL-15 mRNA J. Immunol. 160,936-942[Abstract/Free Full Text]
  35. Bamford, R. N., DeFilippis, A. P., Azimi, N., Kurys, G., Waldmann, T. A. (1998) The 5' untranslated region, signal peptide, and the cording sequence of the carboxyl terminus of IL-15 participate in its multifaceted translational control J. Immunol. 160,4418-4426[Abstract/Free Full Text]
  36. Fehniger, T. A., Shah, M. H., Turner, M. J., VanDeusen, J. B., Whitman, S. P., Cooper, M. A., Suzuki, K., Wechser, M., Coodsaid, F., Caligiuri, M. A. (1999) Differential cytokine and chemokine gene expression by human NK cells following activation with IL-18 or IL-15 in combination with IL-12: implications for the innate immune response J. Immunol. 162,4511-4520[Abstract/Free Full Text]
  37. Seeburg, P. H. (1982) The human growth hormone gene family: nucleotide sequences show recent divergence and predict a new polypeptide hormone DNA 1,249-249
  38. Lewis, D. B., Yu, C. C., Forbush, K. A., Carpenter, J., Sato, T. A., Grossman, A., Liggitt, D. H., Perlmutter, R. M. (1991) Interleukin 4 expressed in situ selectively alters thymocyte development J. Exp. Med. 173,89-100[Abstract/Free Full Text]
  39. Di Carlo, E., Meazza, R., Basso, S., Rosso, O., Comes, A., Gaggero, A., Musiani, P., Santi, L., Ferrini, S. (2000) Dissimilar anti-tumour reactions induced by tumour cells engineered with the interleukin-2 or interleukin-15 gene in nude mice J. Pathol. 191,193-201[Medline]
  40. Bamford, R. N., Grant, A. J., Burton, J. D., Peters, C., Kurys, G., Goldman, C. K., Brennan, J., Roessler, E., Waldmann, T. A. (1994) The interleukin (IL) 2 receptor ß chain is shared by IL-2 and a cytokine, provisionally designated IL-T, that stimulates T-cell proliferation and the induction of lymphokine-activated killer cells Proc. Natl. Acad. Sci. USA 91,4940-4944[Abstract/Free Full Text]
  41. Gaggero, A., Azzarone, B., Andrei, C., Mishal, Z., Meazza, R., Zappia, E., Rubartelli, A., Ferrini, S. (1999) Differential intracellular trafficking, secretion and endosomal localization of two IL-15 isoforms Eur. J. Immunol. 29,1265-1274[Medline]
  42. Meazza, R., Gaggero, A., Neglia, F., Basso, S., Sforzini, S., Pereno, R., Azzarone, B., Ferrini, S. (1997) Expression of two interleukin-15 mRNA isoforms in human tumors does not correlated with secretion: role of different signal peptides Eur. J. Immunol. 17,1049-1054
  43. Onu, A., Phol, T., Krause, H., Bulfone-Paus, S. (1997) Regulation of IL-15 secretion via the leader peptide of two IL-15 isoforms J. Immunol. 158,255-262[Abstract]
  44. Munger, W., DeJoy, S. Q., Jeyaseelan, R., Sr, Torley, L. W., Grabstein, K. H., Eisenmann, J., Paxton, R., Cox, T., Wick, M. M., Kerwar, S. S. (1995) Studies evaluating the antitumor activity and toxicity of interleukin-15, a new T cell growth factor: comparison with interleukin-2 Cell. Immunol. 165,289-293[Medline]
  45. Nishimura, H., Yajima, T., Naiki, Y., Tsunobuchi, H., Umemura, M., Itano, K., Matsuguchi, T., Suzuki, M., Ohashi, P. S., Yoshikai, Y. (2000) Differential roles of interleukin 15 mRNA isoforms generated by alternative splicing in immune responses in vivo J. Exp. Med. 191,157-169[Abstract/Free Full Text]
  46. Carson, W. E., Ross, M. E., Baiocchi, R. A., Marien, M. J., Boiani, N., Grabstein, K., Caligiuri, M. A. (1995) Endogenous production of interleukin 15 by activated human monocytes is critical for optimal production of interferon-{gamma} by natural killer cells in vitro J. Clin. Invest. 96,2578-2581
  47. Gingrich, J. R., Barrios, R. J., Morton, R. A., Boyce, B. F., DeMayo, F. J., Finegold, M. J., Angelopoulou, R., Rosen, J. M., Greenberg, N. M. (1996) Metastatic prostate cancer in a transgenic mouse Cancer Res 56,4096-4102[Abstract/Free Full Text]
  48. Foster, B. A., Gingrich, J. R., Kwon, E. D., Madias, C., Greenberg, N. M. (1997) Characterization of prostatic epithelial cell lines derived from transgenic adenocarcinoma of the mouse prostate (TRAMP) model Cancer Res 57,3325-3330[Abstract/Free Full Text]
  49. Kwon, E. D., Foster, B. A., Hurwitz, A. A., Madias, C., Allison, J. P., Greenberg, N. M., Burg, M. B. (1999) Elimination of residual metastatic prostate cancer after surgery and adjunctive cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) blockade immunotherapy Proc. Natl. Acad. Sci. USA 96,15074-15079[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 BloodHome page
C. L. Sutherland, B. Rabinovich, N. J. Chalupny, P. Brawand, R. Miller, and D. Cosman
ULBPs, human ligands of the NKG2D receptor, stimulate tumor immunity with enhancement by IL-15
Blood, August 15, 2006; 108(4): 1313 - 1319.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
H. Yokoyama, H. Nakanishi, Y. Kodera, Y. Ikehara, N. Ohashi, Y. Ito, M. Koike, M. Fujiwara, M. Tatematsu, and A. Nakao
Biological Significance of Isolated Tumor Cells and Micrometastasis in Lymph Nodes Evaluated Using a Green Fluorescent Protein-Tagged Human Gastric Cancer Cell Line
Clin. Cancer Res., January 15, 2006; 12(2): 361 - 368.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Yajima, H. Nishimura, S. Sad, H. Shen, H. Kuwano, and Y. Yoshikai
A Novel Role of IL-15 in Early Activation of Memory CD8+ CTL after Reinfection
J. Immunol., March 15, 2005; 174(6): 3590 - 3597.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. L. Cook, T. A. Miura, D. N. Ikle, A. M. Lewis Jr., and J. M. Routes
E1A Oncogene-induced Sensitization of Human Tumor Cells to Innate Immune Defenses and Chemotherapy-induced Apoptosis in Vitro and in Vivo
Cancer Res., June 15, 2003; 63(12): 3435 - 3443.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, K.
Right arrow Articles by Yamanaka, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, K.
Right arrow Articles by Yamanaka, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS