* C.N.R. Unit for Muscle Biology and Physiopathology, and
C.R.I.B.I. Center, Department of Biomedical Sciences; and
Institute of Experimental and Laboratory Medicine, University of Padova, Padova, Italy
Correspondence: Marco Sandri, M.D., Department of Biomedical Sciences, University of Padova, Viale Colombo, 3, I-35121 Padova, Italy. E-mail: patgen06{at}civ.bio.unipd.it
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: apoptosis • myoblast • differentiation • inflammation
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Experimental design to inhibit endogenous FasL in inflamed muscles
Muscle inflammation was induced in young adult Swiss mice as
described above. Mice were divided into two groups. One set of animals
were intraperitoneally (i.p.) injected with a recombinant
Fas-immunoglobulin (Ig) molecule (FasL inhibitor, Alexis, San Diego,
CA; 0.1 mg/kg) [9
] at day 3 after damage; the treatment
was repeated daily until the eighth day from injury. Mice were
sacrificed at day 3 (N=6), day 5 (N=6), and day
10 (N=18). The second set of animals were i.p. injected with
control Ig (0.1 mg/kg); treatment and killing times were the same as
the first group. The effect of anti-FasL treatment was also examined on
organs other than skeletal muscles. These included heart, brain, liver,
stomach, intestine, colon, kidney, and spleen.
Histology
Tissue cryosections were made and collected on
polylysine-precoated slides. Slides of tissue preparations were stained
with hematoxylin-eosin and then examined for the level of infiltration
of inflammatory cells or tissue injury.
Immunohistochemical and TUNEL analyses of inflamed muscles
Serial tissue cryosections were made and collected on
polylysine-precoated slides. Slides were incubated with primary
antibodies using the following dilutions: rat anti-Mac1 (Roche
Diagnostics, Nutley, NJ), rat anti-Thy-1 (Pharmingen, San Diego, CA),
rat anti-B220 (Pharmingen), and rabbit anti-MyoD (M318) and rabbit
anti-FasL (Q20, C178, Santa Cruz Biotechnology, Santa Cruz, CA),
diluted 1:100 in 1% bovine serum albumin (BSA). The slides were then
washed with phosphate-buffered saline (PBS), and the immunoreaction was
revealed by TRITC-conjugated, rabbit anti-rat Ig (1:250) for Mac1,
Thy-1.2, and B220 and by biotin-conjugated sheep anti-rabbit (Fab
fragment) for MyoD and FasL. Detection of the FasL and MyoD
immunocomplex was performed by thiol-specific, anti-oxidant
(TSA)-Direct green and blue kits, respectively (NEN Research Products,
Boston, MA). Nuclei were counterstained by Hoechst 33258 or by
propidium iodide (PI). Some sections were double-labeled for the
presence of apoptotic nuclei and Mac1. The slides were processed as
described above; after incubation with TRITC-conjugated antibody, the
slides were rinsed in PBS and then labeled for fragmented DNA (TUNEL)
according to the manufacturer’s instructions (In Situ Cell
Death Detection Kit-POD, distributed by Roche Diagnostics).
Quantification of Mac1, MyoD-positive cells, and TUNEL/Mac1,
double-positive cells was performed and expressed as number of
cells/mm3 in the inflamed area.
Probes
The Bluescript II SK (+) plasmid containing the murine FasL cDNA
was provided by Professor S. Nagata (Osaka, Japan). The pVZCII
3
plasmid containing the murine MyoD cDNA was provided by Dr. R. Kelly
(Paris, France). Probe synthesis and labeling were done by T7/T3
polimerase (sense/antisense) and Biotin RNA labeling mix (Roche
Diagnostics), according to standard protocol [10
,
11
]. Probes were reduced in length by the
alkaline-hydrolysis method and purified.
ISH
Serial tissue cryosections were made and collected on
gelatin-precoated slides. Sections were fixed in 4% paraformaldehyde
(30 min, room temperature), washed in PBS, permeabilized by proteinase
K (5 µg/ml, 8 min), washed twice in PBS, acetylated for 10 min in
acetylation buffer (0.1 M triethanolamine, 0.25% of acetic anhydride
in diethyl pyrocarbonate-treated water), washed in PBS (5 min) and in
0.85% NaCl, dehydrated, and air-dried. Muscle cells cultured on glass
coverslips were washed twice in PBS. C2C12 myoblasts were fixed in 4%
paraformaldehyde (20 min, 4°C), washed in PBS permeabilized by
proteinase K (5 µg/ml, 5 min), washed twice in PBS and in 0.85%
NaCl, dehydrated, and air-dried. Cells and sections were hybridized
overnight at 45°C with 0.2 µg/ml biotin-labeled RNA probe specific
for FasL in hybridization solution [50% formamide, 0.3 M NaCl, 20 mM
Tris/HCl, pH 7.4, 5 mM ethylenediaminetetraacetate (EDTA), pH 8, 10 mM
NaH2PO4, pH 8, 10% dextran sulfate, 1x
Denhardt’s solution, 10 mM dithiothreitol (DTT), and 500 µg/ml
tRNA] according to standard procedure [10
,
11
]. After hybridization, cells were washed twice at
45°C for 5 min in saline sodium citrate (SSC; 150 mM NaCl, 15 mM Na
citrate, pH 7.2) 5x; once in SSC 5x (45°C, 30 min); twice in 50%
formamide SSC 2x (60°C, 10 min); and twice in 10 mM Tris/HCl, pH
7.5, 5 mM EDTA, pH 8, 400 mM NaCl (37°C, 5 min). Unhybridized RNA
were digested by RNase A (20 µg/ml) treatment (37°C, 30 min).
Cells/slides were finally washed one time in 10 mM Tris/HCl, pH 7.5, 5
mM EDTA, pH 8, 400 mM NaCl (37°C, 5 min), one in SSC 1x (37°C, 15
min) and one in SSC 0.1x (37°C, 15 min). Positive, in
situ signals were detected by TSA-Direct green and red kits for
ISH (NEN Research Products). Hybridizations with sense probe, which
were always carried out in parallel to the antisense probe
hybridization, gave no signal. Nuclei were counterstained by Hoechst
33258. Samples were washed three times in PBS, mounted in Elvanol, and
observed under an epifluorescence microscope (Zeiss).
Multiple ISH
Sections and myogenic cells, after the prehybridization steps
described above, were hybridized overnight at 45°C with 0.2 µg/ml
biotin-labeled RNA probe specific for FasL and 0.2 µg/ml
digoxigenin-labeled RNA probe specific for MyoD in hybridization
solution, according to standard procedure [11
].
Hybridization, washing, and RNase A digestion were performed as
described above. Positive, in situ signals for FasL were
detected by TSA-Direct (green) kit for ISH (NEN Research Products).
Digoxigenin detection was performed using the rhodamine-conjugated Fab
fragment of sheep anti-digoxigenin. Hybridizations with sense probes,
which were always carried out in parallel to the antisense probe
hybridization, gave no signals.
Cell culture of myogenic cell line C2C12
Mouse myogenic cell line C2C12 was cultured in Dulbecco’s
modified Eagle’s medium (DMEM)-proliferating medium supplied with 10%
fetal calf serum (FCS), 100 U/ml penicillin, and 100 µg/ml
streptomycin (complete medium) on flasks and on glass coverslips,
gelatin (dissolved in 2% PBS)-coated, at the density of 50,000
cells/cm2. Myotube cultures were obtained after 7 days of
cell culture. The medium was changed after 3 days, and FCS was
substituted with 2% horse serum (HS) to favor the complete fusion of
myoblasts.
Co-cultures of macrophages with C2C12
Monocyte-derived macrophage suspension was obtained as
previously described [12
] and was co-cultured with C2C12
cells; the macrophage/C2C12 ratio was 3/1. Co-cultures were plated with
medium alone or in the presence of recombinant Fas-Ig according to the
manufacturer’s instructions. Control macrophages were plated with
medium alone. At the end of incubation (12 h), cells were fixed,
assayed for macrophage viability by morphology and Mac1 stainings, and
quantified. At least 10 low-magnification fields were analyzed for each
point.
Western blot
Myoblast cell cultures and cryosections of muscles at 1, 2, 4,
5, 8, and 10 days from bupivacaine treatment were lysed in 1% Nonidet
P-40 (NP-40), 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate
(SDS), 12 µg/ml phenylmethylsulfonyl fluoride (PMSF), 30 µl/ml
aprotinin, and 1 mM leupeptin dissolved in PBS. The amount of protein
of each sample was determined by the Lowry method using BSA as
standard. The lysates were dissolved in SDS buffer and analyzed by
SDS-polyacrylamide gel electrophoresis (PAGE), 10% polyacrylamide gel,
and Western blotting (40 µg/lane). The following conditions were used
for antibody binding: anti-FasL, 1:100 (Q20, C178, Santa Cruz
Biotechnology) and anti-rabbit, alkaline phosphatase-linked, 1:4000.
FasL detection by reverse transcriptase-polymerase chain reaction
(RT-PCR) and product sequencing
Total RNA was isolated from young mouse thymus and C2C12 cells
by UltraspecTM RNA Isolation System (Biotex, Houston, TX). First-strand
cDNA synthesis was performed with 2 µg RNA according to
1st Strand cDNA Synthesis Kit for RT-PCR (AMV;
Roche Diagnostics). This cDNA (5%) was used in a first-round PCR with
the sense primer, GAGAAGGAAACCCTTTCCTG (1 µM), up-stream of the ATG
initiation codon and the down-stream primer, ATATTCCTGGTGCCCATGAT (1
µM), down-stream of the TAA termination codon, according to Takahashi
et al. [13
]. Reaction conditions were as
follows: one cycle at 94°C for 3 min; 12 cycles at 94°C for 1 min,
at 55°C for 2 min, and at 72°C for 3 min; and one cycle at 72°C
for 8 min. A 1:20 dilution (2 µl) of the amplification products
served as a template for a second round of PCR amplification with the
nested primers (0.4 µM each) ATGCAG CAGCCCATGAATTAC and
CCATATCTGTCCAGTAGTGC designed to amplify the fragment corresponding to
amino acid residues 1–237, according to French et al.
[14
]. Reaction conditions were as follows: one cycle at
94°C for 3 min; 25 cycles at 94°C for 1 min, at 55°C for 2 min,
and at 72°C for 3 min; and one cycle at 72°C for 8 min. As control,
a single round of PCR amplification was carried out with 1 µl cDNA
and the primer pair GTGGGCCGCTCTAGGCACCAA and CTCTTTGATGTCACGCACGATTTC
(0.4 µM each; Mouse ß-actin Control Amplimer Set, CLONTECH
Laboratories, Inc., Palo Alto, CA). Reaction conditions were identical
to those used in the second-round PCR. The FasL products of the nested
PCR were purified by QIAquick PCR Purification Kit (Qiagen, Germany)
and were sequenced by the dideoxy chain-termination method using the
primer, GTATTTTTCATGGTTCTGGTGG.
Immunocytochemistry
Cells cultured on glass coverslips were washed twice in PBS and
fixed with 2 % of neutral-buffered paraformaldehyde for 20 min at room
temperature or in cold acetone for 10 min and air-dried. Coverslips
were then washed in PBS and incubated overnight at 4°C with the
primary antibodies using the following dilution: rabbit anti-FasL
polyclonal antibody diluted 1:50. After two washes with PBS, coverslips
were incubated with the appropriate, secondary Ab (biotin-conjugated,
goat anti-rabbit IgG, diluted 1:250). All dilutions were in 1% BSA.
Detection of the FasL immunocomplex was performed using TSA-Direct
green kit for immunohistochemistry. Nuclei were counterstained by PI or
Hoechst 33258.
Immunocytochemistry of cocultures
Cells cultured on glass coverslip were washed twice in PBS and
fixed with 2% neutral-buffered paraformaldehyde for 20 min at room
temperature. After washing in PBS, some samples were permeabilized by
incubation with 0.5% Triton X-100 for 6 min at room temperature.
Coverslips were then washed in PBS and incubated overnight at 4°C
with the anti-FasL (1:50) specific for the cytoplasmatic, NH2-terminal
region. After two washes with PBS, coverslips were incubated with the
appropriate secondary Ab (biotin-conjugated, goat anti-rabbit IgG,
diluted 1:250) for 1 h at 37°C and then with streptavidin Cy3
conjugated (1:300) for 1 h at 37°C. All dilutions were in 1%
BSA. Nuclei were counterstained by Hoechst 33258. Coverslips were
washed three times in PBS, mounted in Elvanol, and observed under an
epifluorescence microscope (Zeiss).
Statistics
Student’s t-test was used for statistical analysis,
and data were regarded as statistically significant when
p < 0.05.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
40 kD, as expected [14
, 15
] for FasL
protein (Fig. 1C)
.
 View larger version (37K): [in a new window] |
Figure 1. FasL expression in cultured muscle cells. (A and B) C2C12 myogenic cell
line analyzed for FasL expression. Exponentially growing myogenic cells
show positive immunocytochemical staining (A: original magnification,
400x) and fluorescent ISH (B: original magnification, 400x) for FasL.
Nuclei are counterstained by PI (A) and Hoechst 33258 (B). FasL is
revealed by immunoreaction with polyclonal antibody (C178) after
Western blotting (C). Lysates of myogenic cell lines (lane M) show the
expected band for FasL protein (40 kD) as lysates of thymocytes (lane
T). (D) FasL mRNA expression analysis by RT-PCR performed on total RNA
isolated from thymocytes (lanes 2 and 3) and myogenic cell line C2C12
(lanes 4 and 5) (714 bp). Lanes 3, 5, 7, and 9 represent
negative-control reactions without RT. A single round of PCR to amplify
a 540-bp actin fragment was used to control for equal amounts of cDNA
synthesized in the RT reactions of thymocytes (lanes 6 and 7) and of
C2C12 (lanes 8 and 9). Lane 1, DNA Molecular Weight Marker XIV 100-bp
ladder (Roche Diagnostics).
|
 View larger version (123K): [in a new window] |
Figure 2. Multiple ISH for FasL and MyoD transcripts on myogenic C2C12 cells
after a few hours (6 h) of cell cultures. A biotin-labeled probe for
FasL is revealed by TSA-Direct kit (green) in an exponentially growing
myoblast cell culture. (A) Two FasL-positive cells between others after
double-exposure Hoechst/FasL (C) and single-exposure. In the same
field, two cells revealed by immunoreaction with rhodamine-conjugated,
anti-digoxigenin antibody start to express MyoD transcript (B). The
double-exposure FasL/MyoD (yellow) revealed the coexpression (D; A–D:
original magnification, 200x). Early myotubes, in confluent
muscle-cell cultures, show a faint reaction for FasL transcript (E–H):
contrast phase of small, growing myotubes (E and G); the same myotubes
express a very low level of FasL detected by ISH (F and H: original
magnification, 400x).
|
 View larger version (58K): [in a new window] |
Figure 3. Cultured C2C12 myoblasts induce apoptosis of co-cultured macrophages
through a Fas/FasL-mediated mechanism. C2C12 myoblast and macrophages
co-cultures (A and B). FasL is detected by a polyclonal antibody (Q20)
specific for the amino-terminal region of FasL. At 3 h of
co-culture, one myoblast expressing FasL strongly (red) is present
among macrophages (A: original magnification, 400x). Nuclear
morphology, detected by Hoechst staining, distinguishes the smaller
phagocytic nuclei from the larger myogenic nuclei. At this time, the
macrophage’s C2C12 ratio is still 3:1. At 12 h, most cells are
immunostained (B: original magnification, 400x). Quantification of
macrophages cultured alone and in the presence of myoblasts (C).
Macrophage viability is preserved by a chimeric Fas-Ig protein (1
µg/ml) in co-cultures. Nuclear morphology and TUNEL staining
confirmed that macrophages undergo apoptotic cell death (D and E).
After double-staining for Mac1 (arrows; red) and for TUNEL (green),
some apoptotic macrophages (yellow) are detected (D: original
magnification, 400x). Hoechst-staining reveals the condensed chromatin
in TUNEL-positive cells among normal macrophages and myogenic cells (E:
original magnification, 400x).
|
In vivo FasL is expressed by myoblast during resolution
of muscle inflammation: time course of inflammatory cells, myoblast
proliferation, apoptosis in phagocytic cells, and FasL expression
To confirm in vivo the results obtained in
vitro, the time course of FasL expression during muscle
regeneration was studied, a condition in which myoblast and macrophages
are in close contact. Bupivacaine-induced muscle injury is a
predictable, relatively synchronous process, which is accompanied by a
minimal proliferation of interstitial tissue and by a complete
regeneration of muscle tissue [2
]. For this peculiarity,
it becomes a good model to study muscle cell/macrophage interactions
and the signals that regulate phagocytic disappearance. In our hands,
the time course for inflammatory cells, detected by mAbs, was as
expected [1
, 2
] in that the peak of
phagocytic invasion occurred at the 2nd–3rd day after muscle injury
(Fig. 4
). The phagocytic cells did not return to normal levels before 10
days. Myoblasts, detected by anti-MyoD antibody, started to appear from
the 2nd day and increased until the 4th day after myofiber damage (Fig. 4) . The same trend was detected for the MyoD transcript, which showed a
peak of expression at the 4th day by ISH assay (unpublished results).
The time course of FasL expression was similar to MyoD, being
detectable from the 2nd day after injury and reaching the peak of
expression at the 4th–5th day (Fig. 4)
. The apoptotic, mononucleated
cells, detected after double-staining Mac1/TUNEL, correlate with the
time course of FasL expression and with the decrease of phagocytic
cells (Fig. 4)
. No apoptotic cells were observed in controls and very
few in 10 days of regenerated muscles. The observed variations in FasL
protein level detected by immunohistochemistry were confirmed by blot
results. It is interesting to note that FasL was detected in
full-length (40 kDa) and soluble forms (30 kDa; Fig. 4
). On
muscle sections, ISH confirmed that FasL mRNA was maximally expressed
at day 4 and decreased thereafter, in agreement with the protein
findings (Fig. 5A
5B
5C
5D
5E
5F
5G
). For the cellular localization of FasL in the muscle cells,
we used multiple ISH. FasL (green) was coexpressed with MyoD-positive
cells (red) at days 3–5 (Fig. 5H
5I
5J
5K
5L
5M
5N)
in mononucleated cells, i.e.,
myoblasts. Note the difference in the levels of expression of the two
transcripts; although MyoD mRNA is present in all the cytoplasm, FasL
mRNA is present in the cytoplasm with a spotty pattern. After
double-exposure, few spots are still green, suggesting that non-muscle
cells, i.e., macrophages, could express very low levels of FasL mRNA
(Fig. 5N) .
 View larger version (55K): [in a new window] |
Figure 4. Time course of Mac1, MyoD, FasL, and Mac1/TUNEL-staining during muscle
injury and inflammation. Macrophages are detected by mAb anti-Mac1
(red), and total nuclei are counterstained by Hoechst (blue). MyoD
(blue) and FasL (green) immunoreaction are revealed by TSA-Direct blue
and green, respectively, and total nuclei are counterstained by PI
(red). Double-exposure Mac1 (red)/TUNEL (green) revealed apoptotic
macrophages in the inflammatory area of muscles (original
magnification, 100x). The graphics show the quantification of
macrophages, apoptotic macrophages, FasL-positive cells, and
MyoD-positive muscle cells during muscle inflammation. Data are
expressed as mean ± SD. Western blot of inflamed
muscle. Whole-muscle homogenates were prepared from normal muscles
(lane C) and from 1, 2, 4, 5, 8, and 10 days after muscle damage (1d,
2d, 4d, 5d, 8d, and 10d, respectively) as described in Materials and
Methods. The samples were separated by SDS-PAGE, transferred to
membranes, and then probed for FasL (Q20). Two bands of 40 kDa and
30 kDa correspond to full-length and soluble forms of
FasL.
|
 View larger version (56K): [in a new window] |
Figure 5. Expression of FasL mRNA during muscle inflammation. A biotin-labeled
probe for FasL is revealed by TSA-Direct kit (green) in 1, 2, 3, 4, 5,
8, and 10 days after injury (1d, 2d, 3d, 4d, 5d, 8d, and 10d,
respectively; A–G: original magnification, 100x). Myoblasts, in
vivo, express FasL (H–N: original magnification, 400x). Multiple
ISH for FasL and MyoD transcripts. Hoechst-stained nuclei in injured
area at 4 days from muscle damage (H). In the same field, different
cells detected by immunoreaction with rhodamine-conjugated,
anti-digoxigenin antibody expressed MyoD transcript after
double-exposure Hoechst/MyoD (I) and single-exposure (L). A
biotin-labeled probe for FasL is revealed by TSA-Direct kit (green; M).
The double-exposure FasL/MyoD (yellow) revealed the co-localization of
the two transcripts (N).
|
 View larger version (61K): [in a new window] |
Figure 6. Persistence of macrophages after Fas-Ig treatment. Area of injury and
inflammation in normal mice (control) and normal mice after Fas-Ig
treatment (+Fas-Ig). (A and C) Hematoxylin-eosin staining of injured
muscles at 5 days. (B and D) Immunodetection of macrophages by mAb
(red); nuclei were counterstained by Hoechst 33258. (E and G)
Hematoxylin-eosin staining of muscles at 10 days after injury and (F
and H) immunodetection of macrophages by mAb (A–H: original
magnification, 200x). Quantification of macrophages, myofibers, and
apoptosis of macrophages in the different conditions is expressed in
graphics as mean ± SD.
|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The peak of apoptotic cells detected 24 h after muscle injury is a result of bupivacaine action and aged neutrophils, which are well-known to develop their actions during the first few hours of muscle damage, then replaced by macrophages [1 , 2 , 20 ]. During the first hours after bupivacaine injection, TUNEL-positive myonuclei were also detected. An ultrastructural study showed that bupivacaine produced apoptosis in immature, skeletal-muscle cells and necrosis in adult myofibers [21 ]. However, the possibility that bupivacaine-induced cell death is regulated by mitochondria was suggested recently by Bernardi et al. [22 ]. The authors demonstrated that dysregulation occurred by using isolated, adult myofibers and treating them with bupivacaine, mitochondrial depolarization and permeability transition pore (PTP) opening and releasing cytochrome C and Ca2+. The PTP opening is a pro-apoptotic condition because mitochondria could release some pro-apoptotic factors as cytochrome C, apoptosis-inducing factor, and caspase 3 and 9. From these observations, it appears that apoptotic pathways preceded necrosis, although at later stages, necrosis appears to be the main cause of cell death. In any case, both of the papers underline that the action of bupivacaine is limited to the first hours (12 h) [21 , 22 ]. After this short period, apoptotic cell death is present only in mononucleated, Mac1-positive cells. It is interesting that during this first 12–24 h, apoptosis of neutrophils doesn’t occur via new, FasL expression but is probably induced by other pathways or the release of stored FasL. The finding that FasL mRNA appears only when MyoD-positive muscle cells are detected suggests that myoblasts, directly by producing FasL but also indirectly by inducing FasL expression in inflammatory cells via cytokines, control macrophages. Macrophages are APC, and some myopathy as myasthenia gravis or dermatomyositis are autoimmune diseases characterized by autoantibodies; induction of phagocytic apoptosis might contribute to reduce/prevent the production of anti-muscle-tissue antibodies [3 ]
Indeed, the possibility that an excess of macrophages could be harmful for myogenic precursor for the differentiation program and has to be eliminated is consistent with our data (Fig. 6) . Acute muscle injuries result in a massive arrival of phagocytic cells that remove cellular debris and produce several cytokines [18 ]. In this environment, muscle stem cell is activated to re-enter in cell cycle, to generate an adequate number of myogenic cells, and to produce complete myofibers. A close contact between macrophages, which are the majority, and replicating muscle cells occurs during the first days after injury within the basement membrane of the necrotic myofiber [2 ]. This contact could be critical for myogenic-precursor viability and macrophage elimination. In this system, FasL production could be necessary for myoblasts to protect themselves from the scavenger action of macrophages. This hypothesis seems to be confirmed by results shown in Figure 6 . When the endogenous FasL was blocked with a chimeric protein, high concentrations of macrophages were detected even 10 days after injury/regeneration. The absence of apoptosis in inflammatory cells confirms that FasL is blocked and, consequently, that FasL is a key factor in resolution of muscle inflammation. So the persistence of the inflammatory cells becomes a severe obstacle for myoblast survival and/or differentiation to myofiber (Fig. 6) .
Another hypothesis considers the intriguing possibility that FasL may play opposing roles of cell death and cell growth. It was surprising that T lymphocytes deficient in FADD were shown recently to be not only resistant to FasL-mediated apoptosis but also defective in their proliferative capacity. Moreover, Fas-Fc treatment blocked T-cell proliferation, whereas soluble FasL augmented CD3-induced proliferation [23 ]. The inhibition of myoblast proliferation induced by Fas-Ig treatment suggests a possible role of FasL in myoblast proliferation. We showed that macrophages increased myoblast proliferation in in vitro experiments [12 , 18 ], but we still don’t know which cytokine is involved. We also showed that myoblasts express Fas and that overexpression of FasL induced myoblast cell death [24 ]. The levels of FasL may play two distinct roles for lymphocytes; in our condition, a phagocytic cell could induce low levels of FasL expression in myoblasts, which stimulate myoblast proliferation in an autocrine and paracrine way. Despite this suggestive idea, the in vitro experiments of co-cultures do not support the proliferative action of FasL. In fact, Fas-Ig treatment blocked phagocytic cell death but didn’t block myoblast proliferation. However, because C2C12 is a myogenic cell line, this is not a good experimental model to study the proliferative effect of FasL. An exciting working hypothesis for future years is that pharmacological modulation of this cytokine network could up-regulate muscle regeneration, improving the debris removal and the macrophage-released cytokines to stimulate myoblast proliferation in some degenerative myopathies.
Received March 15, 2000; revised October 18, 2000; accepted October 19, 2000.
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
 |
|
 |
|
  J. L. Moran, Y. Li, A. A. Hill, W. M. Mounts, and C. P. Miller Gene expression changes during mouse skeletal myoblast differentiation revealed by transcriptional profiling Physiol Genomics, August 14, 2002; 10(2): 103 - 111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Kostek, J. A. Dominov, and J. B. Miller Up-Regulation of MHC Class I Expression Accompanies but Is Not Required for Spontaneous Myopathy in Dysferlin-Deficient SJL/J Mice Am. J. Pathol., March 1, 2002; 160(3): 833 - 839. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
