Journal of Leukocyte Biology Myeloid cells, immune suppression, tumor immunology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sandri, M.
Right arrow Articles by Carraro, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sandri, M.
Right arrow Articles by Carraro, U.
(Journal of Leukocyte Biology. 2001;69:482-489.)
© 2001 by Society for Leukocyte Biology

Inhibition of FasL sustains phagocytic cells and delays myogenesis in regenerating muscle fibers

Marco Sandri*,{dagger}, Claudia Sandri*, Barbara Brun*, Emanuele Giurisato{ddagger}, Marcello Cantini{ddagger}, Katia Rossini*, Chiara Destro*, Paola Arslan{dagger} and Ugo Carraro*

* C.N.R. Unit for Muscle Biology and Physiopathology, and
{ddagger} C.R.I.B.I. Center, Department of Biomedical Sciences; and
{dagger} Institute of Experimental and Laboratory Medicine, University of Padova, Padova, Italy

Correspondence: Marco Sandri, M.D., Department of Biomedical Sciences, University of Padova, Viale Colombo, 3, I-35121 Padova, Italy. E-mail: patgen06{at}civ.bio.unipd.it


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Macrophage-muscle cell interactions are complex, and the majority is unknown. The persistence of inflammatory cells in skeletal muscle could be critical for myofiber viability. In the present paper, we show that FasL plays a role in the resolution of muscle inflammation. We analyzed inflamed muscles of normal mice treated from day 3 to day 8 with a FasL inhibitor (Fas-Ig) or with control Ig. Treated muscles were collected at 3, 5, and 10 days. The treatment with recombinant Fas-Ig protein induced a severe persistence of inflammatory cells at 5 days (115,000±27,838 vs. 41,661±6848, p<0.01) and 10 days from injury (145,500±40,850 vs. 5000±1000, p<0.001). Myofiber regeneration was highly impaired (37±14 vs. 252±28, p<0.01). Apoptosis of phagocytic cells was absent during Fas-Ig treatment (0.9±0.6 vs. 1300±150, p<0.0001), but apoptotic, mononucleated cells appeared at day 10, 2 days after the suspension of Fas-Ig administration. The time course of FasL expression during muscle inflammation, at mRNA and protein level, reveals a peak during myoblast proliferation. The peak of FasL expression coincides with the peak of apoptosis of phagocytic cells. In situ hybridization shows the co-expression of FasL and MyoD mRNA in mononucleated cells, i.e., myoblasts. Experiments on the myoblast cell culture confirmed the expression of FasL in myoblasts. The findings shown here indicate one of the pathways to control myoblast-macrophage interaction and might be relevant for the control of inflammatory cells in muscle tissue. Perhaps altering FasL expression with recombinant proteins could ameliorate inflammation in degenerative myopathies and up-regulate muscle regeneration.

Key Words: apoptosis • myoblast • differentiation • inflammation


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Inflammation develops rapidly following muscle injury [1 , 2 ]. Muscle inflammation involves several stages, each characterized by the predominance of different inflammatory cell types. The processes leading to the decrease of inflammatory cells are poorly characterized: They may involve cell death (necrosis or apoptosis) and/or emigration. Recently, it has been shown that in inflamed muscle, macrophage decline occurs via apoptosis [1 , 3 ]. However, the signal responsible for inducing phagocytic cell death in muscle is still unknown. It is unclear if the persistence of inflammatory cells is harmful for muscle cells and if it develops a myositis. Inflammatory myopathies are characterized by a persistent immunoreaction, which is critical for myofiber viability. In dermatomyositis, antibody-mediated humural immunity is thought to be the immune effector mechanism, and in polymyositis, there is evidence that T-cell-mediated cytotoxicity causes muscle damage. In both types of myopathies, phagocytic cells are thought to play an important role in the pathogenesis and development of disease [1 , 4 5 6 ]. Lack of apoptosis in all of these human inflammatory myopathies, despite the wide Fas expression in infiltrating cells, has been found [5 6 7 ]. In several tissues, apoptosis occurs during inflammation and is necessary to redirect the final immuneresponse. In fact, the production of the anti-inflammatory cytokine [interleukin (IL)-10] in the apoptotic cells and targeting of the apoptotic cells to the antigen-presenting cells (APC) result in a Th2-type immune deviation [8 ]. The Fas/FasL system is one of the pathways to induce cell apoptosis. Despite the evidence of Fas in myofiber and the myofiber resistance to Fas-mediated apoptosis [5 , 6 ], the presence and role of FasL in muscle tissue are still unclear. The findings demonstrated from this study explain how inflammatory cells are regulated in muscle tissue, and this may be relevant for the research and treatment of degenerative myopathies.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Animal model of muscle damage
Young adult Swiss mice were used to study muscle inflammation. Muscle damage and inflammation were induced on Tibialis Anterior of both limbs by injection of 0.5% bupivacaine as previously described [2 ]. Mice were sacrificed at different times (1, 2, 3, 4, 5, 8, and 10 days), and muscles (N>6 for each point) were removed. Each muscle was cut at the middle bell; half was used for morphology, immunohistochemistry, and in situ hybridization (ISH), and the other half was used for Western blot analysis.

Experimental design to inhibit endogenous FasL in inflamed muscles
Muscle inflammation was induced in young adult Swiss mice as described above. Mice were divided into two groups. One set of animals were intraperitoneally (i.p.) injected with a recombinant Fas-immunoglobulin (Ig) molecule (FasL inhibitor, Alexis, San Diego, CA; 0.1 mg/kg) [9 ] at day 3 after damage; the treatment was repeated daily until the eighth day from injury. Mice were sacrificed at day 3 (N=6), day 5 (N=6), and day 10 (N=18). The second set of animals were i.p. injected with control Ig (0.1 mg/kg); treatment and killing times were the same as the first group. The effect of anti-FasL treatment was also examined on organs other than skeletal muscles. These included heart, brain, liver, stomach, intestine, colon, kidney, and spleen.

Histology
Tissue cryosections were made and collected on polylysine-precoated slides. Slides of tissue preparations were stained with hematoxylin-eosin and then examined for the level of infiltration of inflammatory cells or tissue injury.

Immunohistochemical and TUNEL analyses of inflamed muscles
Serial tissue cryosections were made and collected on polylysine-precoated slides. Slides were incubated with primary antibodies using the following dilutions: rat anti-Mac1 (Roche Diagnostics, Nutley, NJ), rat anti-Thy-1 (Pharmingen, San Diego, CA), rat anti-B220 (Pharmingen), and rabbit anti-MyoD (M318) and rabbit anti-FasL (Q20, C178, Santa Cruz Biotechnology, Santa Cruz, CA), diluted 1:100 in 1% bovine serum albumin (BSA). The slides were then washed with phosphate-buffered saline (PBS), and the immunoreaction was revealed by TRITC-conjugated, rabbit anti-rat Ig (1:250) for Mac1, Thy-1.2, and B220 and by biotin-conjugated sheep anti-rabbit (Fab fragment) for MyoD and FasL. Detection of the FasL and MyoD immunocomplex was performed by thiol-specific, anti-oxidant (TSA)-Direct green and blue kits, respectively (NEN Research Products, Boston, MA). Nuclei were counterstained by Hoechst 33258 or by propidium iodide (PI). Some sections were double-labeled for the presence of apoptotic nuclei and Mac1. The slides were processed as described above; after incubation with TRITC-conjugated antibody, the slides were rinsed in PBS and then labeled for fragmented DNA (TUNEL) according to the manufacturer’s instructions (In Situ Cell Death Detection Kit-POD, distributed by Roche Diagnostics). Quantification of Mac1, MyoD-positive cells, and TUNEL/Mac1, double-positive cells was performed and expressed as number of cells/mm3 in the inflamed area.

Probes
The Bluescript II SK (+) plasmid containing the murine FasL cDNA was provided by Professor S. Nagata (Osaka, Japan). The pVZCII{alpha}3 plasmid containing the murine MyoD cDNA was provided by Dr. R. Kelly (Paris, France). Probe synthesis and labeling were done by T7/T3 polimerase (sense/antisense) and Biotin RNA labeling mix (Roche Diagnostics), according to standard protocol [10 , 11 ]. Probes were reduced in length by the alkaline-hydrolysis method and purified.

ISH
Serial tissue cryosections were made and collected on gelatin-precoated slides. Sections were fixed in 4% paraformaldehyde (30 min, room temperature), washed in PBS, permeabilized by proteinase K (5 µg/ml, 8 min), washed twice in PBS, acetylated for 10 min in acetylation buffer (0.1 M triethanolamine, 0.25% of acetic anhydride in diethyl pyrocarbonate-treated water), washed in PBS (5 min) and in 0.85% NaCl, dehydrated, and air-dried. Muscle cells cultured on glass coverslips were washed twice in PBS. C2C12 myoblasts were fixed in 4% paraformaldehyde (20 min, 4°C), washed in PBS permeabilized by proteinase K (5 µg/ml, 5 min), washed twice in PBS and in 0.85% NaCl, dehydrated, and air-dried. Cells and sections were hybridized overnight at 45°C with 0.2 µg/ml biotin-labeled RNA probe specific for FasL in hybridization solution [50% formamide, 0.3 M NaCl, 20 mM Tris/HCl, pH 7.4, 5 mM ethylenediaminetetraacetate (EDTA), pH 8, 10 mM NaH2PO4, pH 8, 10% dextran sulfate, 1x Denhardt’s solution, 10 mM dithiothreitol (DTT), and 500 µg/ml tRNA] according to standard procedure [10 , 11 ]. After hybridization, cells were washed twice at 45°C for 5 min in saline sodium citrate (SSC; 150 mM NaCl, 15 mM Na citrate, pH 7.2) 5x; once in SSC 5x (45°C, 30 min); twice in 50% formamide SSC 2x (60°C, 10 min); and twice in 10 mM Tris/HCl, pH 7.5, 5 mM EDTA, pH 8, 400 mM NaCl (37°C, 5 min). Unhybridized RNA were digested by RNase A (20 µg/ml) treatment (37°C, 30 min). Cells/slides were finally washed one time in 10 mM Tris/HCl, pH 7.5, 5 mM EDTA, pH 8, 400 mM NaCl (37°C, 5 min), one in SSC 1x (37°C, 15 min) and one in SSC 0.1x (37°C, 15 min). Positive, in situ signals were detected by TSA-Direct green and red kits for ISH (NEN Research Products). Hybridizations with sense probe, which were always carried out in parallel to the antisense probe hybridization, gave no signal. Nuclei were counterstained by Hoechst 33258. Samples were washed three times in PBS, mounted in Elvanol, and observed under an epifluorescence microscope (Zeiss).

Multiple ISH
Sections and myogenic cells, after the prehybridization steps described above, were hybridized overnight at 45°C with 0.2 µg/ml biotin-labeled RNA probe specific for FasL and 0.2 µg/ml digoxigenin-labeled RNA probe specific for MyoD in hybridization solution, according to standard procedure [11 ]. Hybridization, washing, and RNase A digestion were performed as described above. Positive, in situ signals for FasL were detected by TSA-Direct (green) kit for ISH (NEN Research Products). Digoxigenin detection was performed using the rhodamine-conjugated Fab fragment of sheep anti-digoxigenin. Hybridizations with sense probes, which were always carried out in parallel to the antisense probe hybridization, gave no signals.

Cell culture of myogenic cell line C2C12
Mouse myogenic cell line C2C12 was cultured in Dulbecco’s modified Eagle’s medium (DMEM)-proliferating medium supplied with 10% fetal calf serum (FCS), 100 U/ml penicillin, and 100 µg/ml streptomycin (complete medium) on flasks and on glass coverslips, gelatin (dissolved in 2% PBS)-coated, at the density of 50,000 cells/cm2. Myotube cultures were obtained after 7 days of cell culture. The medium was changed after 3 days, and FCS was substituted with 2% horse serum (HS) to favor the complete fusion of myoblasts.

Co-cultures of macrophages with C2C12
Monocyte-derived macrophage suspension was obtained as previously described [12 ] and was co-cultured with C2C12 cells; the macrophage/C2C12 ratio was 3/1. Co-cultures were plated with medium alone or in the presence of recombinant Fas-Ig according to the manufacturer’s instructions. Control macrophages were plated with medium alone. At the end of incubation (12 h), cells were fixed, assayed for macrophage viability by morphology and Mac1 stainings, and quantified. At least 10 low-magnification fields were analyzed for each point.

Western blot
Myoblast cell cultures and cryosections of muscles at 1, 2, 4, 5, 8, and 10 days from bupivacaine treatment were lysed in 1% Nonidet P-40 (NP-40), 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 12 µg/ml phenylmethylsulfonyl fluoride (PMSF), 30 µl/ml aprotinin, and 1 mM leupeptin dissolved in PBS. The amount of protein of each sample was determined by the Lowry method using BSA as standard. The lysates were dissolved in SDS buffer and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE), 10% polyacrylamide gel, and Western blotting (40 µg/lane). The following conditions were used for antibody binding: anti-FasL, 1:100 (Q20, C178, Santa Cruz Biotechnology) and anti-rabbit, alkaline phosphatase-linked, 1:4000.

FasL detection by reverse transcriptase-polymerase chain reaction (RT-PCR) and product sequencing
Total RNA was isolated from young mouse thymus and C2C12 cells by UltraspecTM RNA Isolation System (Biotex, Houston, TX). First-strand cDNA synthesis was performed with 2 µg RNA according to 1st Strand cDNA Synthesis Kit for RT-PCR (AMV; Roche Diagnostics). This cDNA (5%) was used in a first-round PCR with the sense primer, GAGAAGGAAACCCTTTCCTG (1 µM), up-stream of the ATG initiation codon and the down-stream primer, ATATTCCTGGTGCCCATGAT (1 µM), down-stream of the TAA termination codon, according to Takahashi et al. [13 ]. Reaction conditions were as follows: one cycle at 94°C for 3 min; 12 cycles at 94°C for 1 min, at 55°C for 2 min, and at 72°C for 3 min; and one cycle at 72°C for 8 min. A 1:20 dilution (2 µl) of the amplification products served as a template for a second round of PCR amplification with the nested primers (0.4 µM each) ATGCAG CAGCCCATGAATTAC and CCATATCTGTCCAGTAGTGC designed to amplify the fragment corresponding to amino acid residues 1–237, according to French et al. [14 ]. Reaction conditions were as follows: one cycle at 94°C for 3 min; 25 cycles at 94°C for 1 min, at 55°C for 2 min, and at 72°C for 3 min; and one cycle at 72°C for 8 min. As control, a single round of PCR amplification was carried out with 1 µl cDNA and the primer pair GTGGGCCGCTCTAGGCACCAA and CTCTTTGATGTCACGCACGATTTC (0.4 µM each; Mouse ß-actin Control Amplimer Set, CLONTECH Laboratories, Inc., Palo Alto, CA). Reaction conditions were identical to those used in the second-round PCR. The FasL products of the nested PCR were purified by QIAquick PCR Purification Kit (Qiagen, Germany) and were sequenced by the dideoxy chain-termination method using the primer, GTATTTTTCATGGTTCTGGTGG.

Immunocytochemistry
Cells cultured on glass coverslips were washed twice in PBS and fixed with 2 % of neutral-buffered paraformaldehyde for 20 min at room temperature or in cold acetone for 10 min and air-dried. Coverslips were then washed in PBS and incubated overnight at 4°C with the primary antibodies using the following dilution: rabbit anti-FasL polyclonal antibody diluted 1:50. After two washes with PBS, coverslips were incubated with the appropriate, secondary Ab (biotin-conjugated, goat anti-rabbit IgG, diluted 1:250). All dilutions were in 1% BSA. Detection of the FasL immunocomplex was performed using TSA-Direct green kit for immunohistochemistry. Nuclei were counterstained by PI or Hoechst 33258.

Immunocytochemistry of cocultures
Cells cultured on glass coverslip were washed twice in PBS and fixed with 2% neutral-buffered paraformaldehyde for 20 min at room temperature. After washing in PBS, some samples were permeabilized by incubation with 0.5% Triton X-100 for 6 min at room temperature. Coverslips were then washed in PBS and incubated overnight at 4°C with the anti-FasL (1:50) specific for the cytoplasmatic, NH2-terminal region. After two washes with PBS, coverslips were incubated with the appropriate secondary Ab (biotin-conjugated, goat anti-rabbit IgG, diluted 1:250) for 1 h at 37°C and then with streptavidin Cy3 conjugated (1:300) for 1 h at 37°C. All dilutions were in 1% BSA. Nuclei were counterstained by Hoechst 33258. Coverslips were washed three times in PBS, mounted in Elvanol, and observed under an epifluorescence microscope (Zeiss).

Statistics
Student’s t-test was used for statistical analysis, and data were regarded as statistically significant when p < 0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Myoblasts express FasL in cell cultures
Cell cultures of myogenic cell line C2C12 were tested for the presence of FasL. When we immunostained C2C12 cells with an antibody specific for FasL, a small subset of the mononucleated cells showed the expected staining (Fig. 1A ). The same results were obtained when mRNA expression was analyzed using fluorescent ISH (Fig. 1B) . The percentage of FasL-positive cells ranged from 5–25% in exponentially growing cells. RT-PCR and immunoblotting confirmed that FasL mRNA and protein were expressed in myogenic cell cultures (Fig. 1C and 1D) . From young mouse thymus, in which FasL is expressed, and C2C12 cells, mRNA was examined; the results showed that nested RT-PCR with FasL-specific primers [13 , 14 ] produced a single DNA band that was the expected size (714 bp; Fig. 1D ). The sequence of the PCR product was identical to the coding sequence of the mouse FasL gene [13 ]. On immunoblots probed with anti-FasL monoclonal antibodies (mAbs), thymocytes and C2C12 lysates showed identical bands of ~40 kD, as expected [14 , 15 ] for FasL protein (Fig. 1C) .



View larger version (37K):
[in this window]
[in a new window]
  		Figure 1. FasL expression in cultured muscle cells. (A and B) C2C12 myogenic cell line analyzed for FasL expression. Exponentially growing myogenic cells show positive immunocytochemical staining (A: original magnification, 400x) and fluorescent ISH (B: original magnification, 400x) for FasL. Nuclei are counterstained by PI (A) and Hoechst 33258 (B). FasL is revealed by immunoreaction with polyclonal antibody (C178) after Western blotting (C). Lysates of myogenic cell lines (lane M) show the expected band for FasL protein (40 kD) as lysates of thymocytes (lane T). (D) FasL mRNA expression analysis by RT-PCR performed on total RNA isolated from thymocytes (lanes 2 and 3) and myogenic cell line C2C12 (lanes 4 and 5) (714 bp). Lanes 3, 5, 7, and 9 represent negative-control reactions without RT. A single round of PCR to amplify a 540-bp actin fragment was used to control for equal amounts of cDNA synthesized in the RT reactions of thymocytes (lanes 6 and 7) and of C2C12 (lanes 8 and 9). Lane 1, DNA Molecular Weight Marker XIV 100-bp ladder (Roche Diagnostics).

 
Next, the possible co-expression of FasL with a muscle-specific transcription factor was investigated to study at what stage of muscle differentiation FasL starts to be expressed. Using multiple ISH techniques, we examined possible co-expression of mRNAs for FasL and MyoD, a marker of earlier stages of the myogenic pathway [16 ]. MyoD mRNA was expressed in most FasL-positive cells (Fig. 2A 2B 2C 2D ). The middle stage of myogenic differentiation, characterized by confluent cells and fusion in small myotubes, showed a decrease level of FasL transcript, present at low-level only in some mononucleated cells (<5%) and in a few, small myotubes (Fig. 2E 2F 2G 2H) . At this time, almost all cells express p21 and myogenin, markers of cells that are out of the cell cycle and well-advanced in the differentiation program [17 ]. At later stages of myogenesis when myosins organized in sarcomeres, no myotubes expressed FasL transcript (unpublished results).



View larger version (123K):
[in this window]
[in a new window]
  		Figure 2. Multiple ISH for FasL and MyoD transcripts on myogenic C2C12 cells after a few hours (6 h) of cell cultures. A biotin-labeled probe for FasL is revealed by TSA-Direct kit (green) in an exponentially growing myoblast cell culture. (A) Two FasL-positive cells between others after double-exposure Hoechst/FasL (C) and single-exposure. In the same field, two cells revealed by immunoreaction with rhodamine-conjugated, anti-digoxigenin antibody start to express MyoD transcript (B). The double-exposure FasL/MyoD (yellow) revealed the coexpression (D; A–D: original magnification, 200x). Early myotubes, in confluent muscle-cell cultures, show a faint reaction for FasL transcript (E–H): contrast phase of small, growing myotubes (E and G); the same myotubes express a very low level of FasL detected by ISH (F and H: original magnification, 400x).

 
Cultured myoblasts induce apoptosis of co-cultured macrophages through a Fas/FasL-mediated mechanism
We have shown previously that macrophages increase MyoD-positive cells in co-culture experiments [12 , 18 ]. The possibility that FasL expression is also altered by the presence of macrophages was tested. C2C12 cells were cultured in the presence of an excess of macrophages, and the cultures were monitored for the following 12 h. FasL expression, detected by an antibody specific for the NH2-terminal region of FasL, was increased during the first 12 h (Fig. 3A and B ).



View larger version (58K):
[in this window]
[in a new window]
  		Figure 3. Cultured C2C12 myoblasts induce apoptosis of co-cultured macrophages through a Fas/FasL-mediated mechanism. C2C12 myoblast and macrophages co-cultures (A and B). FasL is detected by a polyclonal antibody (Q20) specific for the amino-terminal region of FasL. At 3 h of co-culture, one myoblast expressing FasL strongly (red) is present among macrophages (A: original magnification, 400x). Nuclear morphology, detected by Hoechst staining, distinguishes the smaller phagocytic nuclei from the larger myogenic nuclei. At this time, the macrophage’s C2C12 ratio is still 3:1. At 12 h, most cells are immunostained (B: original magnification, 400x). Quantification of macrophages cultured alone and in the presence of myoblasts (C). Macrophage viability is preserved by a chimeric Fas-Ig protein (1 µg/ml) in co-cultures. Nuclear morphology and TUNEL staining confirmed that macrophages undergo apoptotic cell death (D and E). After double-staining for Mac1 (arrows; red) and for TUNEL (green), some apoptotic macrophages (yellow) are detected (D: original magnification, 400x). Hoechst-staining reveals the condensed chromatin in TUNEL-positive cells among normal macrophages and myogenic cells (E: original magnification, 400x).

 
A number of macrophages reduce their number in a time-dependent way when they are placed in cultures alone (Fig. 3C) [19 ]; however, when macrophages were co-cultured with myoblasts, a significantly reduced viability of macrophages was observed (Fig. 3C) . This cell death could be inhibited by the addition of a chimeric, Fas-Ig protein (FasL inhibitor, Alexis) to the co-cultures (Fig. 3C) . Triple-staining confirmed that macrophages showed condensed chromatin, detected by Hoechst 33258 (Fig. 3E) , and DNA fragmentation, detected by TUNEL (Fig. 3D) . Thus, myoblasts induced, directly or indirectly, a Fas-dependent cell death in macrophages; however, the presence of macrophages doesn’t affect myoblast survival because our previously published studies showed that macrophages stimulated myoblast proliferation and survival [12 , 18 ].

In vivo FasL is expressed by myoblast during resolution of muscle inflammation: time course of inflammatory cells, myoblast proliferation, apoptosis in phagocytic cells, and FasL expression
To confirm in vivo the results obtained in vitro, the time course of FasL expression during muscle regeneration was studied, a condition in which myoblast and macrophages are in close contact. Bupivacaine-induced muscle injury is a predictable, relatively synchronous process, which is accompanied by a minimal proliferation of interstitial tissue and by a complete regeneration of muscle tissue [2 ]. For this peculiarity, it becomes a good model to study muscle cell/macrophage interactions and the signals that regulate phagocytic disappearance. In our hands, the time course for inflammatory cells, detected by mAbs, was as expected [1 , 2 ] in that the peak of phagocytic invasion occurred at the 2nd–3rd day after muscle injury (Fig. 4 ). The phagocytic cells did not return to normal levels before 10 days. Myoblasts, detected by anti-MyoD antibody, started to appear from the 2nd day and increased until the 4th day after myofiber damage (Fig. 4) . The same trend was detected for the MyoD transcript, which showed a peak of expression at the 4th day by ISH assay (unpublished results). The time course of FasL expression was similar to MyoD, being detectable from the 2nd day after injury and reaching the peak of expression at the 4th–5th day (Fig. 4) . The apoptotic, mononucleated cells, detected after double-staining Mac1/TUNEL, correlate with the time course of FasL expression and with the decrease of phagocytic cells (Fig. 4) . No apoptotic cells were observed in controls and very few in 10 days of regenerated muscles. The observed variations in FasL protein level detected by immunohistochemistry were confirmed by blot results. It is interesting to note that FasL was detected in full-length (~40 kDa) and soluble forms (~30 kDa; Fig. 4 ). On muscle sections, ISH confirmed that FasL mRNA was maximally expressed at day 4 and decreased thereafter, in agreement with the protein findings (Fig. 5A 5B 5C 5D 5E 5F 5G ). For the cellular localization of FasL in the muscle cells, we used multiple ISH. FasL (green) was coexpressed with MyoD-positive cells (red) at days 3–5 (Fig. 5H 5I 5J 5K 5L 5M 5N) in mononucleated cells, i.e., myoblasts. Note the difference in the levels of expression of the two transcripts; although MyoD mRNA is present in all the cytoplasm, FasL mRNA is present in the cytoplasm with a spotty pattern. After double-exposure, few spots are still green, suggesting that non-muscle cells, i.e., macrophages, could express very low levels of FasL mRNA (Fig. 5N) .



View larger version (55K):
[in this window]
[in a new window]
  		Figure 4. Time course of Mac1, MyoD, FasL, and Mac1/TUNEL-staining during muscle injury and inflammation. Macrophages are detected by mAb anti-Mac1 (red), and total nuclei are counterstained by Hoechst (blue). MyoD (blue) and FasL (green) immunoreaction are revealed by TSA-Direct blue and green, respectively, and total nuclei are counterstained by PI (red). Double-exposure Mac1 (red)/TUNEL (green) revealed apoptotic macrophages in the inflammatory area of muscles (original magnification, 100x). The graphics show the quantification of macrophages, apoptotic macrophages, FasL-positive cells, and MyoD-positive muscle cells during muscle inflammation. Data are expressed as mean ± SD. Western blot of inflamed muscle. Whole-muscle homogenates were prepared from normal muscles (lane C) and from 1, 2, 4, 5, 8, and 10 days after muscle damage (1d, 2d, 4d, 5d, 8d, and 10d, respectively) as described in Materials and Methods. The samples were separated by SDS-PAGE, transferred to membranes, and then probed for FasL (Q20). Two bands of ~40 kDa and ~30 kDa correspond to full-length and soluble forms of FasL.

 


View larger version (56K):
[in this window]
[in a new window]
  		Figure 5. Expression of FasL mRNA during muscle inflammation. A biotin-labeled probe for FasL is revealed by TSA-Direct kit (green) in 1, 2, 3, 4, 5, 8, and 10 days after injury (1d, 2d, 3d, 4d, 5d, 8d, and 10d, respectively; A–G: original magnification, 100x). Myoblasts, in vivo, express FasL (H–N: original magnification, 400x). Multiple ISH for FasL and MyoD transcripts. Hoechst-stained nuclei in injured area at 4 days from muscle damage (H). In the same field, different cells detected by immunoreaction with rhodamine-conjugated, anti-digoxigenin antibody expressed MyoD transcript after double-exposure Hoechst/MyoD (I) and single-exposure (L). A biotin-labeled probe for FasL is revealed by TSA-Direct kit (green; M). The double-exposure FasL/MyoD (yellow) revealed the co-localization of the two transcripts (N).

 
Inhibition of FasL induces severe muscle inflammation
We analyzed injured muscles of normal mice, treated from day 3 to day 8 with a FasL inhibitor or with control Ig (Fig. 6 ). On day 3, extensive skeletal-muscle injury with marked infiltration of inflammatory cells and myofiber necrosis was observed in all the samples analyzed. No differences among muscles were observed (p=NS). In the following days, marked differences were detected among samples. The treatment with the recombinant Fas-Ig protein induced a severe persistence of inflammatory cells at 5 days (41,661±6848 vs. 115,000±27,838, p<0.01; mean±SD) and 10 days from injury (5000±1000 vs. 145,500±40,850, p<0.001; Fig. 6 ), and myofiber regeneration was highly impaired (252±28 vs. 37±14, p<0.01; Fig. 6 ). Apoptosis of phagocytic cells was absent during Fas-Ig treatment (1300±150 vs. 0.9±0.6, p<0.0001), but apoptotic, mononucleated cells appeared at day 10, that is, two days after the last injection of Fas-Ig (Fig. 6) , which is known to have a reversible action [9 ]. Lymphocytes, detected by two different mAbs, showed no differences between control and treated muscles during the time-course study. At 10 days, no lymphocytes were detected in treated muscles, suggesting that FasL plays a major role in the control of macrophage-myoblast interactions (unpublished results).



View larger version (61K):
[in this window]
[in a new window]
  		Figure 6. Persistence of macrophages after Fas-Ig treatment. Area of injury and inflammation in normal mice (control) and normal mice after Fas-Ig treatment (+Fas-Ig). (A and C) Hematoxylin-eosin staining of injured muscles at 5 days. (B and D) Immunodetection of macrophages by mAb (red); nuclei were counterstained by Hoechst 33258. (E and G) Hematoxylin-eosin staining of muscles at 10 days after injury and (F and H) immunodetection of macrophages by mAb (A–H: original magnification, 200x). Quantification of macrophages, myofibers, and apoptosis of macrophages in the different conditions is expressed in graphics as mean ± SD.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our results show that, for the first time in skeletal muscle tissue, FasL expression is restricted to a small subset of cells that are in the early stages of the pathway from muscle-progenitor cell to myofiber. The localization of FasL expression, myoblast proliferation, and macrophage cell death in in vivo and in vitro experiments suggests that a complex control of inflammatory cells exists during muscle regeneration. In vitro macrophages undergo apoptosis via the FasL-Fas system [19 ], and in muscle, resolution of inflammation occurs via apoptosis of macrophages [1 , 3 ]. The in vitro results obtained in this study confirm clearly that macrophages undergo spontaneous apoptosis and that the presence of myoblasts increases apoptosis through a Fas-mediated process, because the chimeric protein Fas-Ig blocks phagocytic cell death partially. The in vivo analyses strengthen the concept that phagocytic cells disappear from muscle via apoptosis, as suggested by earlier studies [1 , 3 ] and correlate the peak of apoptosis with the peak of FasL expression. It is well-known that even nonmuscle cells, including phagocytic cells, could express FasL during an inflammatory process as muscle regeneration. However, when we studied the time course of inflammatory cells, we observe that at days 2 and 4, the amount of phagocytic cells is almost similar and not statistically different from the 3rd day of regeneration. Indeed, apoptotic cells increase progressively from days 2–4 in parallel with FasL expression. The number of MyoD-positive cells (committed myoblasts) with a statistically significant increase is what changes during this period (Fig. 4) . The co-localization of FasL and MyoD transcripts confirms that FasL is expressed mainly in myoblasts, even if the protein level is low.

The peak of apoptotic cells detected 24 h after muscle injury is a result of bupivacaine action and aged neutrophils, which are well-known to develop their actions during the first few hours of muscle damage, then replaced by macrophages [1 , 2 , 20 ]. During the first hours after bupivacaine injection, TUNEL-positive myonuclei were also detected. An ultrastructural study showed that bupivacaine produced apoptosis in immature, skeletal-muscle cells and necrosis in adult myofibers [21 ]. However, the possibility that bupivacaine-induced cell death is regulated by mitochondria was suggested recently by Bernardi et al. [22 ]. The authors demonstrated that dysregulation occurred by using isolated, adult myofibers and treating them with bupivacaine, mitochondrial depolarization and permeability transition pore (PTP) opening and releasing cytochrome C and Ca2+. The PTP opening is a pro-apoptotic condition because mitochondria could release some pro-apoptotic factors as cytochrome C, apoptosis-inducing factor, and caspase 3 and 9. From these observations, it appears that apoptotic pathways preceded necrosis, although at later stages, necrosis appears to be the main cause of cell death. In any case, both of the papers underline that the action of bupivacaine is limited to the first hours (12 h) [21 , 22 ]. After this short period, apoptotic cell death is present only in mononucleated, Mac1-positive cells. It is interesting that during this first 12–24 h, apoptosis of neutrophils doesn’t occur via new, FasL expression but is probably induced by other pathways or the release of stored FasL. The finding that FasL mRNA appears only when MyoD-positive muscle cells are detected suggests that myoblasts, directly by producing FasL but also indirectly by inducing FasL expression in inflammatory cells via cytokines, control macrophages. Macrophages are APC, and some myopathy as myasthenia gravis or dermatomyositis are autoimmune diseases characterized by autoantibodies; induction of phagocytic apoptosis might contribute to reduce/prevent the production of anti-muscle-tissue antibodies [3 ]

Indeed, the possibility that an excess of macrophages could be harmful for myogenic precursor for the differentiation program and has to be eliminated is consistent with our data (Fig. 6) . Acute muscle injuries result in a massive arrival of phagocytic cells that remove cellular debris and produce several cytokines [18 ]. In this environment, muscle stem cell is activated to re-enter in cell cycle, to generate an adequate number of myogenic cells, and to produce complete myofibers. A close contact between macrophages, which are the majority, and replicating muscle cells occurs during the first days after injury within the basement membrane of the necrotic myofiber [2 ]. This contact could be critical for myogenic-precursor viability and macrophage elimination. In this system, FasL production could be necessary for myoblasts to protect themselves from the scavenger action of macrophages. This hypothesis seems to be confirmed by results shown in Figure 6 . When the endogenous FasL was blocked with a chimeric protein, high concentrations of macrophages were detected even 10 days after injury/regeneration. The absence of apoptosis in inflammatory cells confirms that FasL is blocked and, consequently, that FasL is a key factor in resolution of muscle inflammation. So the persistence of the inflammatory cells becomes a severe obstacle for myoblast survival and/or differentiation to myofiber (Fig. 6) .

Another hypothesis considers the intriguing possibility that FasL may play opposing roles of cell death and cell growth. It was surprising that T lymphocytes deficient in FADD were shown recently to be not only resistant to FasL-mediated apoptosis but also defective in their proliferative capacity. Moreover, Fas-Fc treatment blocked T-cell proliferation, whereas soluble FasL augmented CD3-induced proliferation [23 ]. The inhibition of myoblast proliferation induced by Fas-Ig treatment suggests a possible role of FasL in myoblast proliferation. We showed that macrophages increased myoblast proliferation in in vitro experiments [12 , 18 ], but we still don’t know which cytokine is involved. We also showed that myoblasts express Fas and that overexpression of FasL induced myoblast cell death [24 ]. The levels of FasL may play two distinct roles for lymphocytes; in our condition, a phagocytic cell could induce low levels of FasL expression in myoblasts, which stimulate myoblast proliferation in an autocrine and paracrine way. Despite this suggestive idea, the in vitro experiments of co-cultures do not support the proliferative action of FasL. In fact, Fas-Ig treatment blocked phagocytic cell death but didn’t block myoblast proliferation. However, because C2C12 is a myogenic cell line, this is not a good experimental model to study the proliferative effect of FasL. An exciting working hypothesis for future years is that pharmacological modulation of this cytokine network could up-regulate muscle regeneration, improving the debris removal and the macrophage-released cytokines to stimulate myoblast proliferation in some degenerative myopathies.


   ACKNOWLEDGEMENTS
 
The financial support of TELETHON-ITALY to the projects, "Role of apoptosis of myofibers, satellite cells and endothelia in exercise-induced muscle damage and in progression of muscular dystrophies (n. 968)" and "FasL expressed in genetically engineered muscles protects the gene therapy immune-rejections? (n. A095)" is gratefully acknowledged. This work was supported in part by funds from the Italian C. N. R. to the Unit for Muscle Biology and Physiopathology and from the Italian Ministero per l’Università e la Ricerca Scientifica e Tecnologica (MURST) ex-60% (to U. C.). M. S. and C. S. contributed equally to this work.

Received March 15, 2000; revised October 18, 2000; accepted October 19, 2000.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Tidball, J. G., St. Pierre, B. A. (1996) Apoptosis of macrophages during resolution of muscle inflammation J. Leukoc. Biol. 59,380-388[Abstract]
  2. Mussini, I., Favaro, G., Carraro, U. (1987) Maturation, dystrophic changes and the continuous production of fibers in skeletal muscle regenerating in the absence of nerve J. Neuropathol. Exp. Neurol. 46,315-331[Medline]
  3. Shi, F. D., Bai, X. F., Li, H. L., Link, H. (1998) Macrophage apoptosis in muscle tissue in experimental autoimmune myasthenia gravis Muscle Nerve 21,1071-1074[Medline]
  4. Fyhr, I. M., Oldfors, A. (1998) Upregulation of Fas/Fas ligand in inclusion body myositis Ann. Neurol. 43,127-130[Medline]
  5. Behrens, L., Bender, A., Johnson, M. A., Hohlfeld, R. (1997) Cytotoxic mechanism in inflammatory myopathies co-expression of Fas and protective bcl-2 in muscle fibres and inflammatory cells Brain 120,929-938[Abstract/Free Full Text]
  6. Schnieder, C., Gold, R., Dalakas, M. C., Schmied, M., Lassmann, H., Toyka, K. V., Hartung, H. P. (1996) MHC class I-mediated cytotoxicity does not induce apoptosis in muscle fibers nor in inflammatory T cells: studies in patients with polymyositis, dermatomyositis and inclusion body myositis J. Neuropathol. Exp. Neurol. 55,1205-1209[Medline]
  7. Inukai, A., Kobayashi, Y., Ito, K., Doyu, M., Takano, A., Honda, H., Sobue, G. (1997) Expression of Fas antigen is not associated with apoptosis in human myopathies Muscle Nerve 20,702-709[Medline]
  8. Gao, B. Y., Herndon, J. M., Zhang, H., Grifitth, T. S., Ferguson, T. A. (1998) Antiinflammatory effects of CD95 ligand (FasL)-induced apoptosis J. Exp. Med. 188,887-896[Abstract/Free Full Text]
  9. Ishiyama, S., Hiroe, M., Nishikawa, T., Shimojo, T., Abe, S., Fujisaki, H., Ito, H., Yamakawa, K., Kobayashi, N., Kasajima, T., Marumo, F. (1998) The Fas/Fas ligand system is involved in the pathogenesis of autoimmune myocarditis in rats J. Immunol. 161,4695-4701[Abstract/Free Full Text]
  10. Dijkman, H. B. P. M., Mentzel, S., de Jong, A. S., Assmann, K. J. M. (1995) RNA in situ hybridization using DIG-labeled cRNA probes Biochemica 2,152-157
  11. Dirks, R. W. (1996) RNA molecules lighting up under the microscope Histochem. Cell Biol. 106,151-166[Medline]
  12. Massimino, M. L., Rapizzi, E., Cantini, M., Libera, L. D., Mazzoleni, F., Arslan, P., Carraro, U. (1997) ED2+ macrophages increase selectively myoblast proliferation in muscle cultures Biochem. Biophys. Res. Commun. 235,754-759[Medline]
  13. Takahashi, T., Tanaka, M., Brannan, C. I., Jenkins, N. A., Copeland, N. G., Suda, T., Nagata, S. (1994) Generalized lymphoproliferative disease in mice, caused by a point mutation in the Fas ligand Cell 76,969-976[Medline]
  14. French, L. E., Wilson, A., Hahne, M., Viard, I., Tschopp, J., MacDonald, H. R. (1997) Fas ligand expression is restricted to nonlymphoid thymic components in situ J. Immunol. 159,2196-2202[Abstract/Free Full Text]
  15. De Maria, R., Testi, R. (1998) Fas-FasL interactions: a common pathogenetic mechanism in organ-specific autoimmunity Immunol. Today 19,121-125[Medline]
  16. Dominov, J. A., Dunn, J. J., Miller, J. B. (1998) Bcl-2 expression identifies an early stage of myogenesis and promotes clonal expansion of muscle cells J. Cell Biol. 142,537-544[Abstract/Free Full Text]
  17. Andres, V., Walsh, K. (1996) Myogenin expression, cell cycle withdrawal, and phenotypic differentiation are temporally separable events that precede cell fusion upon myogenesis J. Cell Biol. 132,657-666[Abstract/Free Full Text]
  18. Cantini, M., Carraro, U. (1995) Macrophage-released factor stimulates selectively myogenic cells in primary muscle culture J. Neuropathol. Exp. Neurol. 54,121-128[Medline]
  19. Kiener, P. A., Davis, P. M., Starling, G. C., Mehlin, C., Klebanoff, S. J., Ledbetter, J. A., Liles, W. C. (1997) Differential induction of apoptosis by Fas-Fas ligand interactions in human monocytes and macrophages J. Exp. Med. 185,1511-1516[Abstract/Free Full Text]
  20. Allbrook, D. (1981) Skeletal muscle regeneration Muscle Nerve 4,234-245[Medline]
  21. Kaminska, A., Fidzianska, A. (1996) Experimental induction of apoptosis and necrosis in neonatal rat skeletal muscle Basic Appl. Myol. 6,251-256
  22. Bernardi, P., Irwin, W., Fontaine, E. (2000) Mitochondria in muscle cell death Basic Appl. Myol. 10,56
  23. Kennedy, N. J., Kataoka, T., Tschopp, J., Budd, R. C. (1999) Caspase activation is required for T cell proliferation J. Exp. Med. 190,1891-1895[Abstract/Free Full Text]
  24. Giurisato, E., Sandri, M., Sandri, C., Zoin, R., Ancona, G. G., Cantini, M. (1998) Proliferating myoblast transfected with FasL can escape from apoptosis Basic Appl. Myol. 8,447-451



This article has been cited by other articles:


Home page
 Physiol. GenomicsHome page
J. L. Moran, Y. Li, A. A. Hill, W. M. Mounts, and C. P. Miller
Gene expression changes during mouse skeletal myoblast differentiation revealed by transcriptional profiling
Physiol Genomics, August 14, 2002; 10(2): 103 - 111.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
C. A. Kostek, J. A. Dominov, and J. B. Miller
Up-Regulation of MHC Class I Expression Accompanies but Is Not Required for Spontaneous Myopathy in Dysferlin-Deficient SJL/J Mice
Am. J. Pathol., March 1, 2002; 160(3): 833 - 839.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sandri, M.
Right arrow Articles by Carraro, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sandri, M.
Right arrow Articles by Carraro, U.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS