Journal of Leukocyte Biology Myeloid cells, immune suppression, tumor immunology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fantuzzi, L.
Right arrow Articles by Gessani, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fantuzzi, L.
Right arrow Articles by Gessani, S.
(Journal of Leukocyte Biology. 2000;68:707-714.)
© 2000 by Society for Leukocyte Biology

IFN-{alpha} and IL-18 exert opposite regulatory effects on the IL-12 receptor expression and IL-12-induced IFN-{gamma} production in mouse macrophages: novel pathways in the regulation of the inflammatory response of macrophages

Laura Fantuzzi*, Patrizia Puddu{dagger}, Barbara Varano*, Manuela Del Cornò*, Filippo Belardelli* and Sandra Gessani*

Laboratories of
* Virology and
{dagger} Immunology, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy

Correspondence: Dr. Sandra Gessani, Laboratory of Virology, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy. E-mail: gessani{at}iss.it


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We characterized the IL-12 response of mouse macrophages in terms of modulation of IFN-{gamma} production by cytokines (IFN-{alpha} and IL-18) and regulation of IL-12 receptor expression. ß1 and ß2 IL-12R chain mRNA expression increased with time in culture in the absence of exogenous stimulation, with concomitant acquisition of responsiveness to IL-12 for IFN-{gamma} production. Expression of the IL-12R ß1 chain mRNA was increased further following IL-12 treatment as a consequence of IFN-{gamma} expression. IL-12 response was regulated differentially by IFN-{alpha} and IL-18. Neutralization of endogenous type I IFN increased IFN-{gamma} secretion, whereas exogenous IFN-{alpha} reduced it. In contrast, IL-18 enhanced IFN-{gamma} mRNA accumulation and IFN-{gamma} secretion in IL-12-stimulated, but not -untreated, cultures. The opposite effects exerted by IFN-{alpha} and IL-18 mirror their mutual capacity of regulating—in a negative or positive manner, respectively—the expression of the IL-12R ß1 chain. We suggest that differential regulation of IL-12 response by IFN-{alpha} and IL-18 can represent previously unrecognized regulatory mechanisms for maintaining suitable levels of differentiation/activation in macrophages.

Key Words: monocytes/macrophages • IL-12 • type I IFN • IL-18


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Interferon (IFN)-{gamma}, a pleiotropic cytokine that regulates a variety of immunological events, is of crucial importance in the development of innate and acquired immunity [1 , 2 ]. In macrophages, this cytokine is involved in cell activation [3 ] as well as in the induction of major histocompatibility complex (MHC) class II antigens [4 , 5 ]. Moreover, it can modulate the proliferation and function of T lymphocytes and enhance the cytolytic activity of natural killer (NK) cells [6 7 8 9 ]. Until recently, T and NK cells were considered the only cell types capable of producing IFN-{gamma} in response to a variety of stimuli. However, convincing evidence is now available about IFN-{gamma} production by human and murine macrophages under certain physiological and pathological conditions [10 11 12 13 14 ].

One of the key events during innate immunity reactions is the production of interleukin (IL)-12 mainly by the macrophages [15 ]. Regulation of IL-12 production during early stages of infection is a critical factor in determining the outcome of a subsequent immune response. In fact, IL-12-induced IFN-{gamma} secretion enhances phagocytosis, production of nitric oxide (NO), and oxidative burst, resulting in increased destruction of pathogens [16 ]. In turn, IFN-{gamma} regulates IL-12 production positively to further amplify the inflammatory response, thus necessitating negative regulators of IL-12 to control inflammation and prevent destruction of the host tissues [15 ]. In this regard, it has been shown that some cytokines, including IL-4, IL-10, type I IFN, and transforming growth factor (TGF)-ß, affect IL-12 production and function negatively [17 18 19 20 ]. IL-12 has pleiotropic effects on different cell functions, including stimulatory effects on NK [21 ] and T cells [22 23 24 ], induction of cytokine expression [21 22 23 24 25 26 ], and enhancement of cytokine activity [22 ]. IL-12 is a cytokine critical for NK cell-mediated IFN-{gamma} production as well as for the generation of IFN-{gamma}-secreting Th1 cells [16 ]. It has been long assumed that the only cells producing IFN-{gamma} in response to IL-12 were T and NK cells. However, recent studies have clearly shown that macrophages and dendritic cells (DC) also exhibit a biological response to this cytokine [27 , 28 ]. IL-12 exerts its biological activities through specific high-affinity receptors [29 , 30 ]. The functional high-affinity receptor complex is composed of at least two independent ß-type receptor subunits, ß1 and ß2, that are gp130-like members of the cytokine receptor superfamily [31 32 33 ]. In addition to T and NK cells, the expression of IL-12 binding sites has been demonstrated in other cell types recently, including DC, neutrophils, B lymphocytes, and microglial cells [34 35 36 37 ].

IL-18 is a recently identified cytokine sharing many functional properties with IL-12. IL-18, originally designated as IFN-{gamma}-inducing factor, augments strongly IFN-{gamma} production by T cells, DC and bone-marrow macrophages, cytotoxicity of NK cells, and T cell proliferation [38 ]. IL-18 acts synergistically with IL-12 in inducing IFN-{gamma} secretion by T and NK cells, bone marrow-derived macrophages, and DC [39 40 41 42 43 44 45 ].

In this study, we have characterized the biological response of peritoneal macrophages (PM) to IL-12 in terms of cytokine-induced modulation of IFN-{gamma} production and expression of IL-12R in these cells. We show that both IL-12R complex components are expressed in PM during in vitro culture in the absence of exogenous stimulation. The extent of their expression correlates with the increased responsiveness to the IL-12-induced IFN-{gamma} production. We also provide evidence that IFN-{alpha} and IL-18 regulate the biological response of PM to IL-12 differently. In fact, IFN-{alpha} regulates the IL-12-induced IFN-{gamma} production negatively, whereas exogenous IL-18 strongly enhanced it. The inhibitory activity of IFN-{alpha}, as well as the enhancing effect by IL-18, appears to be explained by a differential modulation of IL-12R expression. We suggest that the IL-12-induced IFN-{gamma} production by macrophages and its opposite control by IFN-{alpha} and IL-18 can represent missing information, underscoring novel and complex regulatory mechanisms for maintaining a suitable level of differentiation/activation in these cells in response to various environmental stimuli.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice
Male C3H/HeN were obtained from Charles River, Italia S.p.A. (Milan, Italy). Mice were kept under standard pathogen-free conditions and were used within 1 week.

Reagents
Recombinant murine IFN-{alpha}1 was prepared from the culture supernatant of a metastatic murine adenocarcinoma cell (TS/A) transfected with an expression vector containing the mouse IFN-{alpha}1 gene [46 ]. Recombinant murine IFN-{alpha}, A subtype, was purchased from Biosource International (Camarillo, CA). Recombinant murine IL-12 was generously provided by the Genetics Institute, Inc. (Cambridge, MA). Recombinant murine IL-18 was purchased from PeproTech (London, UK). The R4-6A2 rat, mouse hybridoma cell line producing monoclonal antibodies (mAbs) to mouse IFN-{gamma}, was provided by Dr. E. Havell (Trudeau Institute, Saranac Lake, NY; neutralizing titer, 1x105 against 4 U of mouse IFN-{gamma}) [47 ]. RPMI 1640 medium (M.A. Bioproducts, Walkersville, MD) was supplemented with penicillin (100 U/ml), streptomycin (100 µg/ml), L-glutamine (2 mM), and 10% heat-inactivated fetal calf serum (FCS). All tissue culture reagents were purchased as endotoxin-free lots, as assessed by the Limulus amebocyte assay. The origin of the partially purified sheep immunoglobulin (Ig) to mouse IFN-{alpha}/ß (neutralizing titer, 6.4x106 against 4 U of mouse IFN-{alpha}/ß) has been previously described in detail [48 ].

Peritoneal macrophage cultures
Resting PM were harvested by washing the peritoneal cavity with saline and seeded in plastic dishes. For IFN-{gamma} secretion studies, 1x106 total peritoneal cells was seeded in 24-well cluster plates in 1 ml of RPMI 1640 containing 10% FCS. For RNA-polymerase chain reaction (PCR) studies, 12 x 106 total peritoneal cells were seeded in 10 cm Petri dishes in 10 ml of culture medium. After 1 h, nonadherent cells were removed by three washes with medium. PM were then maintained in culture for 4 days in RPMI 1640 containing 10% FCS. Experiments were undertaken when the cells were firmly adherent to the culture wells after vigorous washing. Over 95% of the cells stained for nonspecific esterase and were positive in immunofluorescence studies with mAb (F4/80) specific for mouse macrophages, as described elsewhere [27 ]. F4/80-positive cells have been identified previously as IFN-{gamma}-producing cells [27 ].

RNA-PCR of IL-12 receptor (R) ß1 and ß2 chains and IFN-{gamma}
Total cellular RNA, prepared by the method of Chirgwin et al. [49 ], was reverse-transcribed in a 20 µl reaction containing 0.5 µg total RNA, 0.1 µg oligo-dT (12–18 mer; Pharmacia, Upsala, Sweden), 50 U Moloney murine leukemia virus reverse transcriptase (Gibco BRL, Grand Island, NY), 0.5 mM each of dATP, dCTP, dGTP, and dTTP, and 10 mM DTT, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, and 3 mM MgCl2. After incubation at 37°C for 1 h, 3 µl of the cDNA product was amplified in a 20 µl reaction containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.001% (w/v) gelatine, 0.2 mM each of dATP, dCTP, dGTP, and dTTP, 100 ng each of the gene-specific upstream and downstream primers, and 0.5 U of Taq polymerase (Perkin Elmer Cetus, Norwalk, CT) by using a PTC-100 DNA Thermal Cycler (M.J. Research, Watertown, MA). In some assays, cDNA products were amplified by using 0.1 µg of 32P-labeled sense primer. PCR products were then separated on 2.5% agarose (unlabeled products) or 5% polyacrylamide (labeled products) gels. The length of the amplification products specific for ß1 and ß2 chains was 350 and 690 bp, respectively. The amplification program for IL-12R ß1 and ß2 chains consisted of an initial denaturation of 3 min at 94°C, 1 min at 58°C, and 1 min at 72°C, followed by 35 repeated cycles of denaturation for 1 min at 94°C, primer annealing for 1 min at 58°C, and extension for 1 min at 72°C. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) amplification was run by the same program for 25 cycles. Negative controls lacking template RNA or reverse transcription (RT) were included in each experiment.

The sequences for IL-12R chain primers are as follows: ß1 sense, 5'GAACCACACACACTGTACCCTG; ß1 antisense, 5'TTTAGTGGGTGGCACGAGCC; ß2 sense, 5'CAAGACATCGACTATGACAGAC; and ß2 antisense, 5'CAGGTTGTGCTGTCGAGTCTCG. The sequence of GAPDH primers was previously described [27 ]. PCR analysis of IFN-{gamma} transcripts expression was carried out as described elsewhere [27 ].

IFN-{gamma} assay
Cell supernatants were collected and stored at -80°C. IFN-{gamma} was quantitated by ELISA (INTERTEST-{gamma}, Genzyme, Boston, MA). IFN-{gamma} values (pg/ml) were calculated by regression analyses using a curve generated by different concentrations of standard preparations of IFN-{gamma} (detection range, 128–8200 pg/ml), diluted in RPMI containing 10% FCS.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of IL-12R components during in vitro culture of PM
PM cultured in vitro for 3 days produced IFN-{gamma} in response to exogenous IL-12 [27 ]. However, this response occurred to a greater extent when PM, cultured in the presence of IL-12 for 3 days, were restimulated with IL-12 for an additional 24-h period. This finding suggested the possibility that freshly isolated PM possessed lower levels of IL-12R whose expression was up-modulated by in vitro culture and/or by IL-12 itself. In a first set of experiments, we analyzed the expression of IL-12R ß1 and ß2 chain mRNAs in PM at different times of in vitro culture. As shown in Figure 1 , specific transcripts encoding for the ß1 and ß2 chains of IL-12R were not detected in freshly harvested PM. The expression of the IL-12R ß2 chain started to be detected after 24 h, whereas the ß1 chain mRNA appeared after 48 h. The levels of both transcripts did not vary significantly, although a slight decrease in the expression of the ß2 chain was observed at a later culture time (72 h).



View larger version (96K):
[in this window]
[in a new window]
  		Figure 1. Up-regulation of IL-12R ß1 and ß2 chain expression during in vitro culture of PM. PM were harvested from C3H/HeN mice and seeded in 10 mm plastic dishes at the concentration of 1 x 106 cells/ml in 10 ml of culture medium. Total cellular RNA was extracted after 4, 24, 48, and 72 h of culture and analyzed for the expression of IL-12R ß1 and ß2 chains by RNA-PCR. Amplification products were run on 2.5% agarose gel and visualized by ethidium bromide staining. Results are representative of three independent experiments.

 
Modulation of IL-12R components by IL-12 and role of IL-12-induced IFN-{gamma}
We then investigated whether in vitro culture of PM in the presence of IL-12 could affect the expression of the IL-12R components. Of interest, significantly higher levels of the IL-12R ß1 chain were observed in PM cultured for 3 days in the presence of IL-12 as compared with untreated control cultures (Fig. 2 ). In the same experiment, we analyzed the possible role of the IL-12-induced IFN-{gamma} in the up-modulation of the ß1 chain mRNA by IL-12. As shown in Figure 2 , the culture of PM in the simultaneous presence of IL-12 and antibody to IFN-{gamma} abolished the induction of the ß1 transcripts observed in the presence of IL-12 alone. In contrast, the expression of the IL-12R ß2 chain was not affected significantly by the presence of exogenous IL-12 in the absence or presence of antibody to IFN-{gamma} (Fig. 2) .



View larger version (41K):
[in this window]
[in a new window]
  		Figure 2. Effect of in vitro culture of PM in the continuous presence of IL-12 on the expression of IL-12R components. Role of IFN-{gamma}. PM were prepared and seeded as described in the legend to Figure 1 . Cells were cultured in vitro for 3 days with IL-12 (1 ng/ml) in the absence or presence of antibody to IFN-{gamma} (1000 NU/ml) or left untreated. Then, total cellular RNA was extracted and analyzed for the expression of ß1 and ß2 chains. 32P-labeled amplification products were run on 5% polyacrylamide gel and visualized by autoradiography. A representative experiment out of three is shown.

 
Inhibitory effect of IFN-{alpha} on the biological response of PM to IL-12
Previously, we have demonstrated that freshly isolated macrophages are resistant to the infection with several animal viruses [48 ]. This natural antiviral state is mediated by type I IFN expression and is lost spontaneously during in vitro culture of PM [50 , 51 ]. Interestingly, in vitro-cultured PM proved more sensitive to the effect of IL-12 as compared with freshly harvested PM [27 ]. Thus, we investigated whether the constitutive expression of type I IFN could have some role in the regulation of the biological response of PM to IL-12. In a first set of experiments, PM were cultured in vitro in the presence of antibody to IFN-{alpha}/ß and IL-12. After 3 days, cells were restimulated with IL-12 in the presence of antibody to IFN-{alpha}/ß, and the levels of secreted IFN-{gamma} were measured by ELISA. As shown in Table 1 , neither unstimulated PM nor PM cultures maintained in the presence of antibody to IFN-{alpha}/ß produced detectable levels of IFN-{gamma}. However, the presence of IL-12 during the in vitro culture resulted in a consistent secretion of IFN-{gamma} that was significantly increased by the addition of antibody to IFN-{alpha}/ß. In a second series of experiments, we evaluated whether the addition of exogenous IFN-{alpha} resulted in some inhibition of the biological response of in vitro-cultured PM to IL-12. As shown in Table 2 , PM stimulated by IL-12 in the presence of IFN-{alpha} produced consistently less IFN-{gamma} as compared with control IL-12-stimulated cultures.


View this table:
[in this window]
[in a new window]
  		Table 1. Effect of In Vitro Culture in the Presence of Antibody to Type I IFN on the IL-12-Induced IFN-{gamma} Production by PM

 

View this table:
[in this window]
[in a new window]
  		Table 2. Effect of Exogenous IFN-{alpha} on the IL-12-Induced IFN-{gamma} Production

 
Synergistic activity of IL-18 on the IL-12-induced IFN-{gamma} expression
As shown in Figure 3A , treatment of PM with IL-18 alone did not result in any induction of IFN-{gamma} secretion. However, the addition of IL-18 to IL-12-stimulated cultures strongly enhanced IFN-{gamma} secretion with respect to PM cultures treated with IL-12 alone (Fig. 3A) . Moreover, simultaneous treatment of PM with IL-12 and IL-18 resulted in a significant increase of IFN-{gamma} mRNA accumulation with respect to IL-12 alone (Fig. 3B) . In contrast, IL-18 singly added to PM cultures did not affect IFN-{gamma} mRNA expression.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 3. Synergistic effect of IL-18 on the IL-12-induced IFN-{gamma} expression. (A) PM were harvested from C3H/HeN mice and seeded in 24-well cluster plates at the concentration of 1 x 106 cells/ml in 1 ml of culture medium. Cells were cultured in vitro in the continuous presence of IL-12 alone (1 ng/ml), IL-18 alone (10 and 100 ng/ml), or in the simultaneous presence of IL-12 and IL-18 (1 ng/ml and 10 or 100 ng/ml, respectively). After 3 days, cells were restimulated with the cytokines. Culture supernatants were collected (24 h later), and IFN-{gamma} was titrated by ELISA. (B) PM were prepared and seeded as described in the legend to Figure 1 . Cells were cultured in vitro in the continuous presence of IL-12 alone (1 ng/ml), IL-18 alone (100 ng/ml), or in the simultaneous presence of IL-12 and IL-18 (1 ng/ml and 100 ng/ml, respectively). Then, total cellular RNA was extracted and analyzed for the expression of IFN-{gamma} transcripts by RT-PCR, as described in Materials and Methods.

 
IFN-{alpha} and IL-18 regulate the expression of IL-12R ß1 and ß2 chains differentially
To provide a molecular basis for the inhibitory effect of IFN-{alpha} and the stimulatory activity of IL-18, we carried out experiments aimed at investigating whether the expression of IL-12R ß1 and ß2 chain mRNAs was affected differentially by these cytokines. As shown in Figure 4 , addition of IFN-{alpha} during in vitro culture of PM resulted in a marked reduction in the levels of the IL-12R ß1 chain mRNA as compared with untreated control culture. Expression of the IL-12R ß2 chain was not affected by IFN-{alpha} treatment generally, although a slight reduction of the IL-12 ß2 component was occasionally observed. As shown in Figure 5 , the addition of IL-18 during the in vitro culture of PM did not affect the expression of both receptor chains as compared with unstimulated cultures. However, the simultaneous addition of IL-12 and IL-18 to PM resulted in a marked up-modulation of IL-12R ß1 chain expression with respect to PM treated with IL-12 alone.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 4. Inhibitory effect of exogenous IFN-{alpha} on the expression of IL-12R ß1 and ß2 chains. PM were prepared and seeded as described in the legend to Figure 1 . Cells were maintained for 3 days in the presence or absence of recombinant IFN-{alpha}1 (100 IU/ml) and then processed as described in the legend to Figure 1 . Results are representative of three independent experiments.

 


View larger version (70K):
[in this window]
[in a new window]
  		Figure 5. Synergistic effect of IL-18 on the IL-12-induced up-modulation of the IL-12R ß1 chain. PM were prepared, seeded, and treated as described in the legend to Figure 3B . Total cellular RNA was extracted and analyzed (72 h later) for the expression of IL-12R ß1 and ß2 chains, as described in the legend to Figure 1 .

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we provide the first evidence for the expression of IL-12R mRNA in PM as well as for the opposite regulatory effects exhibited by IFN-{alpha} and IL-18, cytokines capable of differentially regulating IFN-{gamma} production by PM in response to IL-12 itself. Although both IL-12R chains are undetectable in resting, freshly harvested PM soon after cell seeding, their expression starts to be observed after 24–48 h of in vitro culture. We envisage that a very low expression of IL-12R chains in PM may occur in vivo, especially under certain stimulation conditions, and this expression is enhanced following specific cell-to-cell interactions and IL-12 exposure. In this respect, we provide evidence that IL-12 itself is capable of up-regulating the expression of the ß1 chain in PM during the in vitro culture (Fig. 2) . This effect is mediated by IL-12-induced IFN-{gamma} production, because it is abolished completely in the presence of antibody to IFN-{gamma} (Fig. 2) . In keeping with our finding, it has been demonstrated previously that IL-12 can regulate the expression of its own receptor positively in T cells. In particular, Rogge and co-workers [52 ] showed an increased expression of the ß2 chain in human Th1 cells stimulated by IL-12. Furthermore, it has been demonstrated that IFN-{gamma} affect IL-12 responsiveness of human phytohemagglutinin (PHA)-activated T cells positively through the modulation of high-affinity IL-12R expression [53 ]. More recently, Thibodeaux and colleagues [54 ] showed that mRNA for both IL-12R chains was increased in the lymph nodes of IL-12-treated mice. Autocrine regulation of the IL-12R in T cells was shown to be independent of secondary IFN-{gamma} secretion. In light of our results and those shown by other groups [54 ], it is conceivable to assume that IFN-{gamma} may play a different role in the up-modulation of IL-12R components depending on the cell types (T cells vs. macrophages). Interestingly, the strength of the biological response to IL-12 was not governed solely by IL-12R expression, because IL-12-induced IFN-{gamma} secretion from lymph node T cells required cooperation with accessory cells [54 ]. Although we did not measure IL-12R expression at the plasma membrane of PM, our data are strongly consistent with the presence of functional IL-12R in cultured PM. This conclusion is supported by several lines of evidence: 1) IL-12R ß1 and ß2 chain mRNAs are expressed during in vitro culture of PM. 2) The extent of the biological response to IL-12 correlates with the up-regulation of both chains with time in culture. 3) IL-12 addition increases the response to IL-12 itself and results with the up-regulation of the IL-12ß1 chain.

The finding that type I IFN can act as a negative regulator for the production of IFN-{gamma} by IL-12 is particularly intriguing, because it is generally thought that these cytokines may induce a Th-1 type of immune response, generally associated with an enhancement rather than a decrease of IFN-{gamma} production. In fact, some studies in human systems have shown extensively that type I IFN can enhance the production of IFN-{gamma} by specific T cell subsets [52 , 55 , 56 ]. Although data on mouse models do not consistently show an enhanced production of IFN-{gamma} by type I IFN, an important role of endogenous IFN-{alpha} in the Th-1 polarization has been demonstrated [57 ]. Conversely, it is of interest to mention that, in virus-infected mouse models, Cousens and colleagues [19 ] have shown that an enhanced IFN-{gamma} production occurs in vivo in animals treated with antibody to type I IFN or in knock-out mice for the {alpha}/ß IFN receptor. These results suggested that type I IFN can act as a negative regulator for the production of IFN-{gamma} under certain conditions of infection. However, the mechanism involved in these in vivo-occurring events remained unclear [19 ], especially because in vitro studies to characterize the IFN-producing cell are not available yet. In this regard, the data presented in our article may provide an explanation on this issue if we assume that type I IFN acts as a negative or positive regulator of IFN-{gamma} production, depending on the cell type. In this regard, it is interesting to note that some studies showed a functional antagonism between type I and type II IFN in the regulation of macrophage differentiation and cytotoxicity. Although some of the functional activities of IFN-{gamma} are shared somehow with type I IFN, the effects of these cytokines can be qualitatively different. For instance, IFN-ß has been shown to inhibit the IFN-{gamma}-induced up-regulation of MHC class II antigen expression in macrophages [58 , 59 ] by decreasing the steady-state levels of Ia mRNA [60 ]. In particular, Garotta and co-workers [61 ] described a functional antagonism of type I IFN on the capacity of these cells to produce H2O2 during the IFN-{gamma}-induced respiratory burst. Likewise, it has been demonstrated that the inhibitory activity of IFN-ß on the expression of transferrin receptors was reverted partially by IFN-{gamma} in differentiating human monocytes [62 ]. Furthermore, the antagonistic effect of IFN-{alpha} on the IFN-{gamma}-induced expression of IFN consensus sequence-binding protein mRNA has been shown recently [63 ].

In this study, we also demonstrated that IL-18 up-regulates the IL-12-induced IFN-{gamma} secretion strongly. Previous studies have shown synergistic activity of IL-18 on IL-12-stimulated IFN-{gamma} production by a variety of cell types [39 40 41 42 43 44 45 ]. Although IL-18 per se did not induce any up-regulation of IFN-{gamma} mRNA and protein expression, this cytokine exhibited a strong synergistic activity on the IL-12-induced IFN-{gamma} expression at the mRNA and protein levels. Of interest, the opposite effects of IFN-{alpha} or IL-18 on the IL-12-induced IFN-{gamma} production in PM mirror corresponding effects (inhibiting or enhancing, respectively) on the levels of IL-12R ß1 chain mRNA expression, suggesting that a differential regulation of this critical component of the IL-12R can represent the molecular mechanism involved in the different regulatory responses to these cytokines. In this regard, a number of studies have shown that some cytokines, including type I and II IFNs, IL-4, and IL-12 itself, can positively or negatively affect IL-12R expression in human and mouse T cells [52 , 53 , 64 ]. However, no data are available on the expression and regulation of IL-12R components in macrophages. In contrast to T cells, in which IL-12 responsiveness appears to be mainly regulated through the expression of the ß2 IL-12R component, the ß1 chain appears to be a major determinant in the biological response of PM to IL-12.

This study provides the first evidence that IL-18 can regulate IL-12R components when added in combination with IL-12 (Fig. 5) . Notably, an IL-12-induced up-modulation of the expression of IL-18R chain mRNAs has been shown in T and B cells [65 ]. Based on our results and previous studies, we propose the following model consistent with an efficient regulation of macrophage functions in the immune response to pathogens (Fig. 6 ).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 6. Hypothetical model showing the regulation of macrophage functions in the immune response to pathogens by cytokines. The interactions among different cytokines (IL-12, IL-18, and IFN-{alpha}) leading to suppression or stimulation of IFN-{gamma} expression are described.

 
The rapid secretion of IL-12 in response to infections can induce, in autocrine or paracrine manner, secretion of IFN-{gamma} by macrophages, thus triggering their activation. IFN-{gamma} subsequently activates macrophages to produce IL-12 and IL-18 and enhances its own expression in macrophages [11 ]. Such a positive feedback cycle results in a further amplification of IFN-{gamma} production, at least in part mediated through enhancement of the IL-12R ß1 chain in the presence of IL-18. IFN-{alpha}, either endogenously expressed or stimulated by viral infection or bacterial products, could act in a bimodal manner by participating to the restriction of infection spreading and by negatively regulating the production of IFN-{gamma}. The negative effect of IFN-{alpha} on the biological response of PM to IL-12 may be mediated through the suppression of IL-12R ß1 chain expression.

Notably, recent data have shown that IFN-{alpha} interferes with the synthesis of various cytokines and, in some cases, acts as an anti-inflammatory agent [66, and references therein]. Macrophages are crucial players in inflammatory processes. Although the physiological role of macrophage IFN-{gamma} is still matter of debate [14 ], we can assume that the IFN-{alpha}-mediated inhibition of IFN-{gamma} production can play a role in some of the anti-inflammatory effects of IFN-{alpha}. Because macrophage activation is strongly linked to the release of potentially toxic compounds, IFN-{alpha} would have an important regulatory role aimed at turning off macrophage activation at the right time. This, in turn, would avoid that the inflammatory response can become detrimental.

The finding that macrophages can exhibit a biological response to IL-12, differentially regulated by IFN-{alpha} and IL-18, may provide a missing link in our understanding of the pivotal role of these cells in the regulation of the cross-talk between natural and acquired immune responses.


   ACKNOWLEDGEMENTS
 
This work was supported by the "Associazione Italiana Ricerca sul Cancro" (Milan, Italy) and by the Ministry of Health (Special project 1% "Cytokines as adjuvants in the preparation of new generation vaccines"). We thank I. Gresser for providing us with the polyclonal antibody to IFN-{alpha}/ß, G. Trinchieri for IL-12R chain primers, and M. Ferrantini for recombinant IFN-{alpha}1. We are indebted to S. Vogel, G. Trinchieri, and X. J. Ma for helpful discussion. We thank Sabrina Tocchio and Romina Tomasetto for their excellent editorial assistance, Enrico De Vincenzi and Massimo Venditti for their help in harvesting PM. We are indebted to Roberto Gilardi for preparing drawings.

Received February 29, 2000; revised May 22, 2000; accepted May 23, 2000.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Young, H. A., Hardy, K. J. (1990) Interferon-{gamma}: producer cells, activation stimuli, and molecular genetic regulation Pharmacol. Ther. 45,137-151[Medline]
  2. Boehm, U., Klamp, T., Groot, M., Howard, J. C. (1997) Cellular responses to interferon-{gamma} Annu. Rev. Immunol. 15,749-795[Medline]
  3. Nathan, C. F., Prendergast, T. J., Wiebe, M. E., Stanley, E. R., Platzer, E., Remold, H. G., Welte, K., Rubin, B. Y., Murray, H. W. (1984) Activation of human macrophages. Comparison of other cytokines with interferon-{gamma} J. Exp. Med. 160,600-605[Abstract/Free Full Text]
  4. Le, J., Prensky, W., Yip, Y. K., Chang, Z., Hoffman, T., Stevenson, H. C., Balazs, I., Sadlik, J. R., Vilcek, J. (1983) Activation of human monocyte cytotoxicity by natural and recombinant immune interferon J. Immunol. 131,2821-2826[Abstract]
  5. Basham, T. Y., Merigan, T. C. (1983) Recombinant interferon-{gamma} increases HLA-DR synthesis and expression J. Immunol. 130,1492-1494[Abstract]
  6. Gajewski, T. F., Fitch, F. W. (1988) Anti-proliferative effect of IFN-{gamma} in immune regulation. IFN-{gamma} inhibits the proliferation of Th2 but not Th1 murine helper T lymphocyte clones J. Immunol. 140,4245-4252[Abstract]
  7. Liu, Y., Janeway, C. A., Jr (1990) Interferon {gamma} plays a critical role in induced cell death of effector T cell: a possible third mechanism of self-tolerance J. Exp. Med. 172,1735-1739[Abstract/Free Full Text]
  8. Gidlung, M., Orn, A., Wigzell, H., Senik, A., Gresser, I. (1978) Enhanced NK cell activity in mice injected with interferon and interferon inducers Nature 273,759-761[Medline]
  9. Claeys, H., Van Damme, J., De Ley, M., Vermylen, C., Billiau, A. (1982) Activation of natural cytotoxicity of human peripheral blood mononuclear cells by interferon: a kinetic study and comparison of different interferon types Br. J. Haematol. 50,85-94[Medline]
  10. Fultz, M. J., Barber, S. A., Dieffenbach, C. W., Vogel, S. N. (1993) Induction of IFN-{gamma} in macrophages by lipopolysaccharide Int. Immunol. 5,1383-1392[Abstract/Free Full Text]
  11. Di Marzio, P., Puddu, P., Conti, L., Belardelli, F., Gessani, S. (1994) Interferon {gamma} upregulates its own gene expression in mouse peritoneal macrophages J. Exp. Med. 179,1731-1736[Abstract/Free Full Text]
  12. Robinson, B. W., McLemore, T. L., Crystal, R. G. (1985) Gamma interferon is spontaneously released by alveolar macrophages and lung T lymphocytes in patients with pulmonary sarcoidosis J. Clin. Invest. 75,1488-1495
  13. Fenton, M. J., Vermeulen, M. W., Kim, S., Burdick, M., Strieter, R. M., Kornfeld, H. (1997) Induction of {gamma} interferon production in human alveolar macrophages by Mycobacterium tuberculosis Infect. Immun. 65,5149-5156[Abstract]
  14. Gessani, S., Belardelli, F. (1998) IFN-{gamma} expression in macrophages and its possible biological significance Cytokine Growth Factor Rev 9,117-123[Medline]
  15. Trinchieri, G. (1998) Interleukin-12: a cytokine at the interface of inflammation and immunity Adv. Immunol. 70,83-243[Medline]
  16. Trinchieri, G., Gerosa, F. (1996) Immunoregulation by interleukin-12 J. Leukoc. Biol. 59,505-511[Abstract]
  17. Koch, F., Stanzl, U., Jennewein, P., Janke, K., Heufler, C., Kampgen, E., Romani, N., Schuler, G. (1996) High level IL-12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10 J. Exp. Med. 184,741-746[Abstract/Free Full Text]
  18. D’Andrea, A., Aste-Amezaga, M., Valiante, N. M., Ma, X., Kubin, M., Trinchieri, G. (1993) Interleukin 10 (IL-10) inhibits human lymphocyte interferon-{gamma} production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells J. Exp. Med. 178,1041-1048[Abstract/Free Full Text]
  19. Cousens, L. P., Orange, J. S., Su, H. C., Biron, C. A. (1997) Interferon-{alpha}/ß inhibition of interleukin 12 and interferon-{gamma} production in vitro and endogenously during viral infection Proc. Natl. Acad. Sci. USA 94,634-639[Abstract/Free Full Text]
  20. Bright, J. J., Sriram, S. (1998) TGF-ß inhibits IL-12-induced activation of Jak-STAT pathway in T lymphocytes J. Immunol. 161,1772-1777[Abstract/Free Full Text]
  21. Kobayashi, M., Fitz, L., Ryan, M., Hewick, R. M., Clark, S. C., Chan, S., Loudon, R., Sherman, F., Perussia, B., Trinchieri, G. (1989) Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes J. Exp. Med. 170,827-845[Abstract/Free Full Text]
  22. Schmitt, E., Hoehn, P., Huels, C., Goedert, S., Palm, N., Rude, E., Germann, T. (1994) T helper type 1 development of naive CD4+ T cells requires the coordinate action of interleukin-12 and interferon-{gamma} and is inhibited by transforming growth factor-ß Eur. J. Immunol. 24,793-798[Medline]
  23. Gately, M. K., Wolitzky, A. G., Quinn, P. M., Chizzonite, R. (1992) Regulation of human cytolytic lymphocyte responses by interleukin-12 Cell. Immunol. 143,127-142[Medline]
  24. Trinchieri, G. (1993) Interleukin-12 and its role in the generation of Th1 cells Immunol. Today 14,335-338[Medline]
  25. Chan, S. H., Perussia, B., Gupta, J. W., Kobayashi, M., Pospisil, M., Young, H. A., Wolf, S. F., Young, D., Clark, S. C., Trinchieri, G. (1991) Induction of interferon {gamma} production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers J. Exp. Med. 173,869-879[Abstract/Free Full Text]
  26. Chan, S. H., Kobayashi, M., Santoli, D., Perussia, B., Trinchieri, G. (1992) Mechanisms of IFN-{gamma} induction by natural killer cell stimulatory factor (NKSF/IL-12). Role of transcription and mRNA stability in the synergistic interaction between NKSF and IL-2 J. Immunol. 148,92-98[Abstract]
  27. Puddu, P., Fantuzzi, L., Borghi, P., Varano, B., Rainaldi, G., Guillemard, E., Malorni, W., Nicaise, P., Wolf, S. F., Belardelli, F., Gessani, S. (1997) IL-12 induces IFN-{gamma} expression and secretion in mouse peritoneal macrophages J. Immunol. 159,3490-3497[Abstract]
  28. Ohteki, T., Fukao, T., Suzue, K., Maki, C., Ito, M., Nakamura, M., Koyasu, S. (1999) Interleukin 12-dependent interferon {gamma} production by CD8{alpha}+ lymphoid dendritic cells J. Exp. Med. 189,1981-1986[Abstract/Free Full Text]
  29. Gubler, U., Presky, D. H. (1996) Molecular biology of interleukin-12 receptors Ann. N. Y. Acad. Sci. 795,36-40[Medline]
  30. Gately, M. K., Renzetti, L. M., Magram, J., Stern, A. S., Adorini, L., Gubler, U., Presky, D. H. (1998) The interleukin-12/interleukin-12-receptor system: role in normal and pathologic immune responses Annu. Rev. Immunol. 16,495-521[Medline]
  31. Chua, A. O., Chizzonite, R., Desai, B. B., Truitt, T. P., Nunes, P., Minetti, L. J., Warrier, R. R., Presky, D. H., Levine, J. F., Gately, M. K., Gubler, U. (1994) Expression cloning of a human IL-12 receptor component. A new member of the cytokine receptor superfamily with strong homology to gp130 J. Immunol. 153,128-136[Abstract]
  32. Chua, A. O., Wilkinson, V. L., Presky, D. H., Gubler, U. (1995) Cloning and characterization of a mouse IL-12 receptor-ß component J. Immunol. 155,4286-4294[Abstract]
  33. Presky, D. H., Yang, H., Minetti, L. J., Chua, A. O., Nabavi, N., Wu, C-Y., Gately, M. K., Gubler, U. (1996) A functional interleukin 12 receptor complex is composed of two ß-type cytokine receptor subunits Proc. Natl. Acad. Sci. USA 93,14002-14007[Abstract/Free Full Text]
  34. Grohmann, U., Belladonna, M. L., Bianchi, R., Orabona, C., Ayroldi, E., Fioretti, M. C., Puccetti, P. (1998) IL-12 acts directly on DC to promote nuclear localization of NF-{kappa}B and primes DC for IL-12 production Immunity 9,315-323[Medline]
  35. Collison, K., Saleh, S., Parhar, R., Meyer, B., Kwaasi, A., Al-Hussein, K., Al-Sedairy, S., Al-Mohanna, F. (1998) Evidence for IL-12-activated Ca2+ and tyrosine signaling pathways in human neutrophils J. Immunol. 161,3737-3745[Abstract/Free Full Text]
  36. Vogel, L. A., Showe, L. C., Lester, R., McNutt, R. M., Van Cleave, V. H., Metzger, D. W. (1996) Direct binding of IL-12 to human and murine B lymphocytes Int. Immunol. 8,1955-1962[Abstract/Free Full Text]
  37. Suzumura, A., Sawada, M., Takayanagi, T. (1998) Production of interleukin-12 and expression of its receptors by murine microglia Brain Res 787,139-142[Medline]
  38. Okamura, H., Tsutsi, H., Komatsu, T., Yutsudo, M., Hakura, A., Tanimoto, T., Torigoe, K., Okura, T., Nukada, Y., Hattori, K. (1995) Cloning of a new cytokine that induces IFN-{gamma} production by T cells Nature 378,88-91[Medline]
  39. Micallef, M. J., Ohtsuki, T., Kohno, K., Tanabe, F., Ushio, S., Namba, M., Tanimoto, T., Torigoe, K., Fujii, M., Ikeda, M., Fukuda, S., Kurimoto, M. (1996) Interferon-{gamma}-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-{gamma} production Eur. J. Immunol. 26,1647-1651[Medline]
  40. Robinson, D., Shibuya, K., Mui, A., Zonin, F., Murphy, E., Sana, T., Hartley, S. B., Menon, S., Kastelein, R., Bazan, F., O’Garra, A. (1997) IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF-{kappa}B Immunity 7,571-581[Medline]
  41. Zhang, T., Kawakami, K., Qureshi, M. H., Okamura, H., Kurimoto, M., Saito, A. (1997) Interleukin-12 (IL-12) and IL-18 synergistically induce the fungicidal activity of murine peritoneal exudate cells against Cryptococcus neoformans through production of {gamma} interferon by natural killer cells Infect. Immun. 65,3594-3599[Abstract]
  42. Yoshimoto, T., Okamura, H., Tagawa, Y. I., Iwakura, Y., Nakanishi, K. (1997) Interleukin 18 together with interleukin 12 inhibits IgE production by induction of interferon-{gamma} production from activated B cells Proc. Natl. Acad. Sci. USA 94,3948-3953[Abstract/Free Full Text]
  43. Munder, M., Mallo, M., Eichmann, K., Modolell, M. (1998) Murine macrophages secrete interferon {gamma} upon combined stimulation with interleukin (IL)-12 and IL-18: a novel pathway of autocrine macrophage activation J. Exp. Med. 187,2103-2108[Abstract/Free Full Text]
  44. Sugaya, M., Nakamura, M., Tamaki, K. (1999) Interleukin 18 and 12 synergistically upregulate interferon-{gamma} production by murine dendritic epidermal T cells J. Invest. Dermatol. 113,350-354[Medline]
  45. Fukao, T., Matsuda, S., Koyasu, S. (2000) Synergistic effects of IL-4 and IL-18 on IL-12-dependent IFN-{gamma} production by dendritic cells J. Immunol. 164,64-71[Abstract/Free Full Text]
  46. Ferrantini, M., Giovarelli, M., Modesti, A., Musiani, P., Modica, A., Venditti, M., Peretti, E., Lollini, P-L., Nanni, P., Forni, G., Belardelli, F. (1994) IFN-{alpha} 1 gene expression into a metastatic murine adenocarcinoma (TS/A) results in CD8+ T cell-mediated tumor rejection and development of antitumor immunity. Comparative studies with IFN-{gamma}-producing TS/A cells J. Immunol. 153,4604-4615[Abstract]
  47. Gresser, I., Belardelli, F., Maury, C., Maunoury, M. T., Tovey, M. G. (1983) Injection of mice with antibody to interferon enhances the growth of transplantable murine tumors J. Exp. Med. 158,2095-2107[Abstract/Free Full Text]
  48. Belardelli, F., Vignaux, F., Proietti, E., Gresser, I. (1984) Injection of mice with antibody to interferon renders peritoneal macrophages permissive for vesicular stomatitis virus and encephalomyocarditis virus Proc. Natl. Acad. Sci. USA 81,602-606[Abstract/Free Full Text]
  49. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease Biochemistry 18,5294-5299[Medline]
  50. Proietti, E., Gessani, S., Belardelli, F., Gresser, I. (1986) Mouse peritoneal cells confer an antiviral state on mouse cell monolayers: role of interferon J. Virol. 57,456-463[Abstract/Free Full Text]
  51. Gessani, S., Dieffenbach, C. W., Conti, L., Di Marzio, P., Wilson, K. L., Belardelli, F. (1993) Selective alteration of the turnover of interferon-ß mRNA in peritoneal macrophages from LPS-hyporesponsive mice and its role in the defective expression of spontaneous interferon Virology 193,507-509[Medline]
  52. Rogge, L., Barberis-Maino, L., Biffi, M., Passini, N., Presky, D. H., Gubler, U., Sinigaglia, F. (1997) Selective expression of an interleukin-12 receptor component by human T helper 1 cells J. Exp. Med. 185,825-831[Abstract/Free Full Text]
  53. Gollob, J. A., Kawasaki, H., Ritz, J. (1997) Interferon-{gamma} and interleukin-4 regulate T cell interleukin-12 responsiveness through the differential modulation of high-affinity interleukin-12 receptor expression Eur. J. Immunol. 27,647-652[Medline]
  54. Thibodeaux, D. K., Hunter, S. E., Waldburger, K. E., Bliss, J. L., Trepicchio, W. L., Sypek, J. P., Dunussi-Joannopoulos, K., Goldman, S. J., Leonard, J. P. (1999) Autocrine regulation of IL-12 receptor expression is independent of secondary IFN-{gamma} secretion and not restricted to T and NK cells J. Immunol. 163,5257-5264[Abstract/Free Full Text]
  55. Brinkmann, V., Geiger, T., Alkan, S., Heusser, C. H. (1993) Interferon {alpha} increases the frequency of interferon {gamma}-producing CD4+ T cells J. Exp. Med. 178,1655-1663[Abstract/Free Full Text]
  56. Romagnani, S. (1992) Induction of TH1 and TH2 response: a key role for the "natural" immune response? Immunol. Today 13,379-381[Medline]
  57. Finkelman, F. D., Svetic, A., Gresser, I., Snapper, C., Holmes, J., Trotta, P. P., Katona, I. M., Gause, W. C. (1991) Regulation by interferon {alpha} of immunoglobulin isotype selection and lymphokine production in mice J. Exp. Med. 174,1179-1188[Abstract/Free Full Text]
  58. Inaba, K., Kitaura, M., Kato, T., Watanabe, Y., Kawade, Y., Muramatsu, S. (1986) Contrasting effect of alpha/beta- and gamma-interferons on expression of macrophages Ia antigens J. Exp. Med. 163,1030-1035[Abstract/Free Full Text]
  59. Ling, P. D., Warren, M. K., Vogel, S. N. (1985) Antagonist effect of interferon-ß on the interferon-{gamma} induced expression of Ia antigen in murine macrophages J. Immunol. 135,1857-1863[Abstract]
  60. Fertsch, D., Schoenberg D. R., Germain R. N., Vogel, S. N. (1987) Induction of macrophage Ia antigen expression by rIFN-gamma and down-regulation by IFN-alpha/beta and dexamethasone are mediated by changes in steady-state levels of Ia mRNA. 139, 244–249.
  61. Garotta, G., Talmadge, K. W., Pink, J. R., Dewald, B., Baggiolini, M. (1986) Functional antagonism between type I and type II interferons on human macrophages Biochem. Biophys. Res. Commun. 140,948-954[Medline]
  62. Testa, U., Conti, L., Sposi, N. M., Varano, B., Tritarelli, E., Malorni, W., Samoggia, P., Rainaldi, G., Peschle, C., Belardelli, F., Gessani, S. (1995) IFN-ß selectively down-regulates transferrin receptor expression in human peripheral blood macrophages by a post-translational mechanism J. Immunol. 155,427-435[Abstract]
  63. Fultz, M. J., Vogel, S. N. (1998) Analysis of the antagonistic effect of IFN-alpha on IFN-gamma-induced interferon consensus sequence binding protein messenger RNA in murine macrophages J. Inflamm. 48,28-39[Medline]
  64. Szabo, S. J., Dighe, A. S., Gubler, U., Murphy, K. M. (1997) Regulation of the interleukin (IL)-12R ß2 subunit expression in developing T helper 1 (Th1) and Th2 cells J. Exp. Med. 185,817-824[Abstract/Free Full Text]
  65. Yoshimoto, T., Takeda, K., Tanaka, T., Ohkusu, K., Kashiwamura, S-I., Okamura, H., Akira, S., Nakanishi, K. (1998) IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-{gamma} production J. Immunol. 161,3400-3407[Abstract/Free Full Text]
  66. Tilg, H. (1997) New insights into the mechanisms of interferon {alpha}: an immunoregulatory and anti-inflammatory cytokine Gastroenterology 112,1017-1021[Medline]



This article has been cited by other articles:


Home page
 Toxicol SciHome page
M. T. Borchers, S. C. Wesselkamper, B. L. Eppert, G. T. Motz, M. A. Sartor, C. R. Tomlinson, M. Medvedovic, and J. W. Tichelaar
Nonredundant Functions of {alpha}{beta} and {gamma}{delta} T Cells in Acrolein-Induced Pulmonary Pathology
Toxicol. Sci., September 1, 2008; 105(1): 188 - 199.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
P. Puddu, M. Carollo, I. Pietraforte, F. Spadaro, M. Tombesi, C. Ramoni, F. Belardelli, and S. Gessani
IL-2 induces expression and secretion of IFN-{gamma} in murine peritoneal macrophages
J. Leukoc. Biol., September 1, 2005; 78(3): 686 - 695.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. D. Finkelman, M. Yang, C. Perkins, K. Schleifer, A. Sproles, J. Santeliz, J. A. Bernstein, M. E. Rothenberg, S. C. Morris, and M. Wills-Karp
Suppressive Effect of IL-4 on IL-13-Induced Genes in Mouse Lung
J. Immunol., April 15, 2005; 174(8): 4630 - 4638.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
U. Schleicher, A. Hesse, and C. Bogdan
Minute numbers of contaminant CD8+ T cells or CD11b+CD11c+ NK cells are the source of IFN-{gamma} in IL-12/IL-18-stimulated mouse macrophage populations
Blood, February 1, 2005; 105(3): 1319 - 1328.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
T. Musikacharoen, A. Oguma, Y. Yoshikai, N. Chiba, A. Masuda, and T. Matsuguchi
Interleukin-15 induces IL-12 receptor {beta}1 gene expression through PU.1 and IRF 3 by targeting chromatin remodeling
Blood, January 15, 2005; 105(2): 711 - 720.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
D. Durali, M.-G. de Goer de Herve, J. Giron-Michel, B. Azzarone, J.-F. Delfraissy, and Y. Taoufik
In human B cells, IL-12 triggers a cascade of molecular events similar to Th1 commitment
Blood, December 1, 2003; 102(12): 4084 - 4089.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Parham, M. Chirica, J. Timans, E. Vaisberg, M. Travis, J. Cheung, S. Pflanz, R. Zhang, K. P. Singh, F. Vega, et al.
A Receptor for the Heterodimeric Cytokine IL-23 Is Composed of IL-12R{beta}1 and a Novel Cytokine Receptor Subunit, IL-23R
J. Immunol., June 1, 2002; 168(11): 5699 - 5708.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
K. R. B. Bastos, J. M. Alvarez, C. R. F. Marinho, L. V. Rizzo, and M. R. D'Imperio Lima
Macrophages from IL-12p40-deficient mice have a bias toward the M2 activation profile
J. Leukoc. Biol., February 1, 2002; 71(2): 271 - 278.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Gigliotti Rothfuchs, D. Gigliotti, K. Palmblad, U. Andersson, H. Wigzell, and M. E. Rottenberg
IFN-{alpha}{beta}-Dependent, IFN-{gamma} Secretion by Bone Marrow-Derived Macrophages Controls an Intracellular Bacterial Infection
J. Immunol., December 1, 2001; 167(11): 6453 - 6461.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow