Journal of Leukocyte Biology Accuri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sadahira, Y.
Right arrow Articles by Naito, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sadahira, Y.
Right arrow Articles by Naito, M.
(Journal of Leukocyte Biology. 2000;68:464-470.)
© 2000 by Society for Leukocyte Biology

Impaired splenic erythropoiesis in phlebotomized mice injected with CL2MDP-liposome: an experimental model for studying the role of stromal macrophages in erythropoiesis

Yoshito Sadahira*, Tatsuji Yasuda{dagger}, Tadashi Yoshino{ddagger}, Toshiaki Manabe*, Toshiyuki Takeishi§, Yoshiaki Kobayashi§, Yusuke Ebe§ and Makoto Naito§

* Department of Pathology, Kawasaki Medical School, Kurashiki;
{dagger} Department of Cell Chemistry, Institute of Molecular Biology and Cell Biology;
{ddagger} Department of Pathology, Okayama University Medical School, Okayama; and
§ Department of Pathology, Niigata University School of Medicine, Niigata, Japan

Correspondence: Yoshito Sadahira, M.D., Department of Pathology, Kawasaki Medical School, 577 Matsushima, Kurashiki 701-0192, Japan. E-mail: sadapath{at}med.kawasaki-m.ac.jp


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Erythropoiesis occurs in the presence of erythropoietin (EPO) without macrophages in vitro. In hematopoietic tissues, however, erythroid cells associate closely with stromal macrophages, forming erythroblastic islands via interactions with adhesion molecules. To elucidate the role of macrophages in erythropoiesis, we selectively abrogated stromal macrophages of splenic red pulp of phlebotomized mice by injection with dichloromethylene diphosphonate encapsulated in multilamellar liposomes (CL2MDP-liposome). In the spleen, no erythropoietic activity occurred until 5 days after the treatment. Colony assay revealed that the erythropoiesis was suppressed at the level of CFU-E. The splenic erythropoietic activity gradually developed from day 6 after the treatment, when F4/80+ macrophages began to appear in the red pulp. EPO mRNA was expressed in kidney but not in liver or spleen of phlebotomized mice injected with CL2MDP-liposome, and the serum EPO concentration in these mice was higher than that in phlebotomized mice. These findings suggest that abrogation of stromal macrophages by injection with CL2MDP-liposome impairs the splenic microenvironment for erythropoiesis induced by hypoxic stress, and this may be an excellent experimental model for further characterization of the in vivo role of splenic macrophages in erythropoiesis.

Key Words: hypoxia • erythroblasts • erythropoietin • adhesion • microenvironment


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It has been demonstrated in mice that spleen is a suitable organ for erythropoiesis [1 ]. This supportive role for the spleen in erythropoiesis becomes clear under strong stimuli that decrease oxygen to tissues [2 , 3 ]. After severe phlebotomy, the contribution of spleen to erythropoiesis increases from ~10% in normal mice to over 40% in phlebotomized mice [4 ]. Erythroid progenitor cells, burst-forming unit-erythroids (BFU-E) and colony-forming unit (CFU)-E, explosively proliferate and differentiate in response to the rise in erythropoietin (EPO) concentration [2 , 3 ]. This strong splenic erythropoietic activity following phlebotomy can be explained by the idea that spleen stromal components provide a particularly suitable microenvironment for erythropoiesis [4 ]. In this regard, macrophages have long been considered to occupy a central role for establishing a microenvironment for erythropoiesis because they were typically observed at the center of erythropoietic islands in bone marrow and spleen [5 6 7 8 ]. However, the precise role of macrophages and the mechanisms by which they exert their effects on erythroid development remain unclear.

To elucidate the role of macrophages in vivo, several substances including silica and dichloromethylene-diphosphonate (CL2MDP)-liposome have been applied in vivo [9 ]. Silica and CL2MDP-liposome are both cytotoxic to macrophages, but the mode of action in killing was different. CL2MDP-liposome suppresses macrophages to produce interleukin (IL)-1, IL-6, and tumor necrosis factor (TNF)-{alpha}, whereas sublethal doses of silica stimulate macrophages to these cytokines. In addition, the specificity of the CL2MDP-liposome in splenic red pulp stromal macrophage depletion has been shown clearly in vivo in a considerable number of studies [9 10 11 ].

The present study examined the possible role of the macrophages in splenic erythropoiesis, by injection of CL2MDP-liposome into mice in which erythropoiesis had been stimulated by phlebotomy. The treatment induced depletion of stromal macrophages in the splenic red pulp, accompanied by the withdrawal of erythropoietic activity. This is the first convincing demonstration that splenic stromal macrophages play an in vivo role in erythropoiesis.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Preparation of liposomes
Multilamellar liposomes were prepared as described previously with slight modification [10 , 12 ]. In brief, 100 µmoles of egg yolk phosphatidyl choline (Nihon-Seika, Osaka, Japan), 80 µmoles of cholesterol (Sigma, St. Louis, MO), and 10 µmoles of diacethylphosphate (Sigma) were dissolved in chloroform in a pear-shaped flask. After the solvent was removed by rotary evaporation at 40°C and vacuum dessication, the lipids were dispersed by gentle rotation in 1.0 ml phosphate-buffered saline (PBS), in which 235 mg CL2MDP (Kissei Pharmaceutical, Tokyo, Japan) had been dissolved. The resulting liposomes were centrifuged twice at 20,000 g for 30 min to remove free, nontrapped CL2MDP. The CL2MDP-liposomes (sealing efficiency was about 1%) were then resuspended in 5.0 ml PBS. Drug-free liposomes (PBS-liposomes) were also prepared by the same procedure.

Treatment of mice
Eight-week-old BALB/c mice weighing 20–24 g (SLC, Hamamatsu, Japan) were injected i.v. with 0.4 ml PBS, 58 mg/ml CL2MDP solution, PBS-liposome suspension, or CL2MDP-liposome suspension. In the phlebotomy group, the mice were bled into heparinized capillary tubes from the retroorbital sinus (0.5 ml), and then 30 min later, they were injected i.v. with 0.4 ml, 58 mg/ml CL2MDP solution, PBS-liposome suspension, or CL2MDP-liposome suspension. The animals were killed at various times after the treatment.

Preparation of cells
Femora were excised from the mice after killing by cervical dislocation. Proximal edges of the femora were cut, and bone marrow fragments were obtained by inserting a 27-gauge needle to the distal edge and by flushing the femora using a syringe. Bone marrow cells were prepared using the syringe. Splenic cells were prepared by meshing the spleens in a Potter’s-type homogenizer, which allowed splenic cells to be detached completely from white fibrous connective tissues and provided a single cell suspension.

Hematopathological studies
Hematologic evaluation consisting of hematocrit and reticulocyte count was performed at each point. Blood was obtained by heparinized capillary tubes from the retroorbital sinus. Hematocrit was determined by the routine method [3 ]. Blood smears were stained with new methylene blue for manual reticulocyte counts. The mice were then killed by cervical dislocation, and spleens were excised. The spleen was weighed and cut in three pieces. A splenic stamp was made from one piece. Erythropoietic activity was determined from the percent of erythroblasts in 200 nucleated cells counted in the splenic stamps. Another piece of spleen was fixed with 20% buffered formalin that was dehydrated in alcohol and embedded in paraffin. Then 4 µm sections were stained with hematoxylin-eosin (H-E) and observed under a light microscope.

Hematopoietic progenitor cell assay
The number of CFU-E, BFU-E, and CFU-granulocytes and macrophages (GM) was determined using a methylcellulose culture kit (#HCC-3444, Stem Cell Technologies, Vancouver, Canada). Briefly, 104/mL bone marrow cells or 105/mL splenic cells were inoculated in Iscoves’ MDM medium containing 0.9% methylcellulose, 15% fetal bovine serum (FBS), 10-4 mol/L 2-mercaptoethanol, 2 mM L-glutamine, 3 U/mL recombinant human (rh) EPO, 50 ng/mL recombinant mouse stem-cell factor (rm-SCF), 10 ng/mL mouse recombinant IL-3, 10 ng/mL rh-IL-6, 200 µg/mL human transferring, and 10 µg/mL bovine serum albumin. Aliquots of 1 mL were plated in duplicate 35 mm plastic dishes and incubated at 37°C in 5% CO2. CFU-E was counted at day 2. CFU-GM and BFU-E were counted at day 7. Colony types were determined by observation in situ using an inverted microscope, according to a method described previously [13 ].

Antibodies
EB1 [rat anti-mouse erythrocyte band 3 protein monoclonal antibody (mAb)] and F10 (rat anti-Forssman glycosphingolipid mAb) were produced in our laboratory as described previously [14 , 15 ]. F4/80 (rat anti-mouse macrophage mAb) [16 ] was a gift from Dr. Simon Gordon (University of Oxford, Oxford, UK). M1/70 (rat anti-mouse Mac-1/CD11b mAb) [17 ], R1/2 (rat anti-mouse {alpha}4 integrin/CD49d mAb) [18 ], and TER-119 (rat anti-mouse erythrocyte mAb) [19 ] were obtained from PharMingen (San Diego, CA). Rabbit anti-active form of caspase-3 antiserum [20 ] was purchased from Genzyme (Cambridge, MA).

Immunohistochemistry
Cryostat sections were prepared by embedding the spleen, liver, and bone marrow in Tissue Tek OCT compound (Miles, Naperville, IL) and then snap-freezing in n-hexane cooled to -80°C. Acetone-fixed 6 µm-thick sections were stained with mAbs using an indirect method or an avidin-biotin peroxidase complex (ABC) method as described previously [15 ]. For the identification of erythroid cells with EB1 mAb, the ABC method was performed on paraffin-embedded sections [14 ].

Double-flow cytometric analysis
A 100 µl cell suspension containing ~1 x 107 cell/ml in RPMI-1640 supplemented with 10% fetal calf serum (FCS) and 0.1% sodium azide was mixed with 2 µg TER 119 for 30 min at 4°C. After sequential washing with PBS supplemented with 10 mM HEPES, 2.5% normal horse serum, and 10 mM sodium azide, samples were mixed with 40 µl of 1:80 diluted fluorescein isothiocyanate (FITC)-conjugated goat F(ab)'2 anti-rat immunoglobulin G (IgG; Zymed Lab, San Francisco, CA) for 30 min at 4°C. After washing, 5 µl of biotin-labeled R1/2 or M1/70 was added, and the mixture was kept on ice. Thirty minutes later, 20 µl of 1:80 diluted phycoerythrin-conjugated streptoavidine (Vector Lab, Burlingame, CA) was added to the solution, which was then kept on ice for a further 30 min. Negative controls were treated with unrelated isotype-matched mAb. After a final washing, samples were fixed with 1 ml PBS containing 2% paraformaldehyde and then analyzed with a fluorescein-activated cell sorter (FACS) Calibur (Becton-Dickinson, Mountain View, CA).

Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of EPO
Total cellular RNA was isolated from the kidney, liver, spleen, and bone marrow of each mouse using ISOGEN (Wako Pure Chemical industries, Osaka, Japan), according to the manufacturer’s instructions. In brief, at 3 days after treatment of the mice with phlebotomy and CL2MDP-liposomes, the tissues were removed and homogenized at room temperature in 1 ml of ISOGEN solution in a glass Teflon homogenizer and transferred to a 2 ml polypropylene tube. Subsequently, 0.2 ml of chloroform was added to the homogenate. After centrifugation, the aqueous phase was transferred to a fresh tube, mixed with 0.5 ml isopropanol, and kept at room temperature for 10 min to precipitate RNA. After centrifugation, the RNA pellet was washed in 1 ml of 75% ethanol, air dried, and resolved in diethyl pyrocarbonate (DEPC)-treated water. The RNA was quantified in a nucleic acid spectrometer (GeneQuant, Pharmacia, Uppsala, Sweden), and its purity was assessed on the basis of the A260/280 ratio. To obtain single-stranded cDNAs, 2 µg total RNA was mixed with 0.5 µg oligo (dT)12–18 in 12 µl DEPC-treated water and incubated at 70°C for 10 min and then on ice for 2 min. The RNA/primer mixture was mixed with 2 µl of 10x PCR buffer, 2 µl of 25 mM MgCl2, 1 µl of 10 mM dNTPs, and 0.1 M dithiothreitol (DTT); incubated at 42°C for 5 min; and then supplemented with 1 µl (200 units) SuperScript II RT. The mixture was incubated at 42°C for 50 min, and the reaction was terminated by incubating at 72°C for 15 min. The samples were treated with RNase H. PCR amplification was performed using an ASTEC program temperature-control system PC-800 (SCI-MEDIA Ltd., Tokyo, Japan). The reaction mixture consisted of 2 µl sample cDNA, 5 µl PCR amplification buffer, 2 µl of 25 mM MgCl2, 4.0 µl of 2.5 mM dNTPs, 0.3 µl of 5 U/µl Taq polymerase, 2 µl of 20 µM primer, and 29.7 µl double-distilled water, with a final volume of 47 µl. Samples were amplified for 27 (ß-actin) or 40–45 (EPO) cycles with denaturation at 94°C for 1 min, annealing at 55°C (ß-actin) or 60°C (EPO) for 2 min, and extension at 72°C for 3 min. A final extension at 72°C for 7 min was performed after the last cycle. In each experiment, the hot start method was used. The PCR products were separated on a 1.2% low melting-point agarose gel containing 0.3 µg/ml (0.003%) ethidium bromide, and bands were visualized and photographed using ultraviolet transillumination. PCR primers for murine EPO and ß-actin were made to order by Kurabo Biomedicals (Osaka, Japan). The following were the sequences for each primer: mouse EPO [21 ], sense; TCCTTGCTACTGATTCCTCTGG, antisense; AAGTATCCACTGTGAGTGTTCG, mouse ß-actin, sense; TGGAATCCTGTGGCATCCATGAAAC, antisense; TAAAACGCAGCTCAGTAACAGTCCG. The predicted size of the amplified products for EPO was 451 bp; ß-actin, 348 bp.

Serum EPO assay
Serum EPO concentration was measured using a radioimmunoassay kit (Japan DPC, Chiba, Japan), originally developed for determinations in man using anti-human EPO antibody known to cross-react with mouse EPO [22 ], according to the manufacturer’s instructions.

Injection of rh-EPO into phlebotomized mice treated with CL2MDP-liposome
rh-EPO (ESPO, Kirin Brewery Co., Gunma, Japan) [23 ] was diluted to the desired concentration in PBS with 0.5% normal mouse serum. Phlebotomized mice injected with CL2MDP-liposome were injected i.p. with rh-EPO (15 U/mouse or 150 U/mouse) four times. These injections were initiated 15 h after the treatment of phlebotomy and CL2MDP-liposome injection. The mice were killed at day 4 for hematopathological study and hematopoietic progenitor assay as described above.

Statistics
Significance was calculated by Student’s t-test. P values at <0.05 were considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Effect of CL2MDP-liposome injection on macrophage distribution
The kinetics of macrophage loss of various organs in normal mice after treatment with CL2MDP-liposome has been described previously [10 11 12 ]. In the spleen of phlebotomized mice injected with MDP-liposomes, elimination of red pulp macrophages was confirmed by immunoperoxidase staining of frozen sections with two different mAbs: F4/80 and F10 (anti-Forssman glycosphingolipid mAb), both of which have been shown to react with stromal macrophages in hematopoietic foci in the bone marrow and splenic red pulp. F4/80+ macrophages were eliminated mostly 1 day after the treatment (day 1) but reappeared at day 5 and gradually increased in number (Table 1 ). The numbers of the F4/80+ macrophages in the red pulp had almost recovered to the normal level by day 12. Forssman+ macrophages, identified by F10, which have been shown to be a subpopulation of mature red pulp F4/80+ macrophages closely associated with developing hematopoietic cells [24 , 25 ], were also eliminated at day 1. These Forssman+ macrophages were not detected until day 14 (Table 1 , Fig. 1A and B ). In phlebotomized mice injected with PBS-liposome or CL2MDP solution, macrophages were not eliminated from any tissues examined.


View this table:
[in this window]
[in a new window]
  		Table 1. Kinetics of Macrophage Loss in Splenic Red Pulp After Phlebotomy and CL2MDP-Liposome Injection

 


View larger version (153K):
[in this window]
[in a new window]
  		Figure 1. A, B: Immunohistochemical distribution of Forssman+ stromal macrophages in the spleen of phlebotomized mice (A, original magnification, x100) and phlebotomized mice injected with CL2MDP-liposome (B, original magnification, x100) 4 days after treatment. C, D: Distribution of erythroblasts defined by immunostaining with anti-band 3 protein mAbs (EB1) in the spleen of phlebotomized mice (C, original magnification, x100) and phlebotomized mice injected with CL2MDP-liposome (D, original magnification, x100) 4 days after treatment. Both sections were counterstained with methyl green. In phlebotomized mice, there were erythroblasts and erythrocytes, which were both labeled with EB1. After injection with CL2MDP-liposome, however, erythroblasts disappeared in the spleen, and only erythrocytes were seen. W, white pulp. E, F: Immunostaining of spleen red pulp with the anti-active form of capase-3 antibodies 4 days after treatment. The number of positive cells (arrowheads) in phlebotomized mice injected with CL2MDP-liposome (F, original magnification, x100) was more than that in phlebotomized mice (E, original magnification, x100).

 
Effect of CL2MDP-liposome injection on erythropoiesis promoted by phlebotomy
Phlebotomy itself significantly induced a drop in the hematocrit value, an increase in the reticulocyte count, and an increase in erythroblast count in the spleen (unpublished results). Similar effects were also observed in phlebotomized mice injected with PBS-liposome (Fig. 2 ). In the spleen of phlebotomized mice injected with CL2MDP-liposome, however, erythropoietic activity did not develop until day 6 (Fig. 2C) . Histologically, CL2MDP-liposome treatment deprived splenic red pulp of EB1-positive erythroblasts (Fig. 1D) . It is interesting that increased numbers of cells were stained with the anti-active form of caspase-3 antibodies at day 4 (Fig. 1F) . At day 6, a few small erythropoietic foci appeared in the red pulp and gradually grew until day 12. In blood, the reticulocyte count gradually increased from day 6, reaching maximum at day 12, and then dropped after day 14, accompanied by recovery of the hematocrit value (Fig. 2A and 2B) .



View larger version (12K):
[in this window]
[in a new window]
  		Figure 2. Sequential changes in the hematocrit value (A), percent reticulocyte count in blood (B), and percent erythroblast count in the spleen stamps (C) of phlebotomized mice injected with PBS-liposome (•) and phlebotomized mice injected with CL2MDP-liposome ({circ}). Percent of erythroblast count was calculated by counting 200 nucleated cells in the splenic stamps Data are mean ± SD of four mice. *Phlebotomy + CL2MDP-liposome vs. phlebotomy + PBS-liposome, p < 0.05.

 
We next performed double-flow cytometric analysis of spleen cells 4 days after treatment (Fig. 3 ). The erythroblast fraction was clearly detectable as CD49d+ TER-119+ [8 , 19 ] or Mac-1-TER-19+. Compared with normal mice, CD49d+ TER-119+ or Mac-1-TER-19+ cells increased in number in phlebotomized mice and phlebotomized mice with injection of PBS-liposome. In contrast, the number of CD49d+ TER-119+ or Mac-1-TER-19+ cells did not increase in phlebotomized mice injected with CL2MDP-liposome.



View larger version (47K):
[in this window]
[in a new window]
  		Figure 3. Two-color flow-cytometric analysis of spleen cells of normal mice (A, E), phlebotomized mice (B, F), phlebotomized mice injected with PBS-liposome (C, G), and phlebotomized mice injected with CL2MDP-liposome (D, H) at 4 days after treatment. Spleen cells were double-stained with anti-erythrocyte mAb, TER-119 (FL-1), and anti-{alpha}4 integrin mAb (CD49d), R1/2 (FL-2), or anti-Mac-1 mAb (FL-2). A total of 5 x 104 spleen cells were analyzed with a gate established for lymphocytes using forward and side-angle light scattering. The findings are representative of two independent experiments.

 
Effect of CL2MDP-liposome injection on the number of hematopoietic progenitor cells
To determine the level of suppression of erythropoiesis by CL2MDP-liposome, the number of erythroid and myeloid hematopoietic progenitor cells in the spleen was quantified using methylcellulose cultures at day 3 (Table 2 ). Phlebotomy induced a doubling in the number of total splenic nucleated cells, a 30-fold increase in the number of CFU-E, and an 8-fold increase in the number of BFU-E. In the spleen of the phlebotomized mice treated with CL2MDP-liposome, total splenic nucleated cell counts were similar to those in normal mice, and there was no expansion of CFU-E numbers. No suppressive effects on splenic erythropoiesis were observed in phlebotomized mice injected with PBS-liposome or CL2MDP solution (23.2 mg/mouse).


View this table:
[in this window]
[in a new window]
  		Table 2. Number of Total Nuclear Cells (TNC), Erythroid Precursor Cells (CFU-E and BFU-E), and Myeloid Precursor Cells (CFU-GM) in the Spleen at Day 3

 
Effect of CL2MDP-liposome injection on EPO mRNA expression and serum EPO concentration
To clarify whether the local production of EPO was modulated by the treatment with CL2MDP-liposomes, we examined mRNA expression of EPO in kidney, spleen, and liver at day 3. In all groups (normal mice, phlebotomized mice, and phlebotomized mice, injected with CL2MDP-liposomes), EPO mRNA was not detected in the spleen and liver, but was clearly expressed in the kidney (Fig. 4 ). At day 3, serum EPO concentrations of phlebotomized mice were significantly increased compared with that of normal mice (57.8±12.0 mU/ml vs. 22.8±2.9 mU/ml, p<0.001, n=5). Interestingly, serum EPO concentrations of phlebotomized mice injected with CL2MDP-liposome were significantly higher than that of phlebotomized mice (101±15.8 mU/ml vs. 57.8±12.0 mU/ml, p<0.01, n=5).



View larger version (26K):
[in this window]
[in a new window]
  		Figure 4. RT-PCR analysis of EPO mRNA expression in the kidneys, spleens, and livers of normal mice, phlebotomized mice, and phlebotomized mice injected with CL2MDP-liposome at day 3. EPO mRNA was clearly detected in kidneys of all mice. However, this was not detected in spleens and livers even after phlebotomy.

 
Effect of CL2MDP-liposome on in vitro colony formation of CFU-E
To clarify whether CL2MDP itself is cytotoxic to CFU-E, the colony number of CFU-E (% control) was compared by directly adding CL2MDP to the in vitro colony assay. Even 0.188 mg/ml CL2MDP (theoretically calculated maximal concentration in the mouse serum) showed no significant effects on in vitro colony formation of bone marrow CFU-E compared with control culture (85±12% vs. 100±9%, p>0.05, n=4). Therefore, suppression of splenic CFU-E does not appear to be induced by the drug toxicity to splenic CFU-E.

Effects of rh-EPO injection on erythropoiesis of phlebotomized mice treated with CL2MDP-liposome
We examined the effect of injection with rh-EPO on the hematopoietic parameters of phlebotomized mice treated with CL2MDP-liposome. The findings are shown in Table 3 . Injection of rh-EPO (total 60 U/mouse) did not recover splenic erythropoiesis, but injection of a high dose of rh-EPO (total 600 U/mouse) recovered the number of splenic CFU-E to one-fourth of those of phlebotomized mice at day 4. The immunohistochemical study using erythroid-specific EB1 mAb and F4/80 confirmed that the high-dose rh-EPO injection induced EB1-positive erythroblasts, and these erythroblasts were not associated with macrophages (unpublished results).


View this table:
[in this window]
[in a new window]
  		Table 3. Effect of Erythropoietin (EPO) on Splenic Erythropoiesis of Phlebotomized Mice Injected with CL2MDP-Liposome at Day 4

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The present study clearly demonstrated that injection of CL2MDP-liposome led to failure of the expansion of splenic CFU-E. Because injection of CL2MDP-liposome abrogated stromal macrophages in splenic red pulp, it suggested that depletion of the macrophages from the spleen led to the inability of the spleen to raise an erythropoietic response to hypoxia. Further evidence of a close association of erythropoietic activity with macrophages is that recovery of erythropoietic activity coincided with redistribution of F4/80+ macrophages in the red pulp.

In contrast to the present findings, Wang et al. [26 ] suggested a negative regulatory role for macrophages in murine erythropoiesis in vivo. This difference may be a result of a difference in the definition of macrophages used. In their experiments, macrophages were defined as Mac-1+ cells. Mac-1 is expressed in monocytes but scarcely expressed in stromal macrophages in hematopoietic tissues [7 , 17 , 25 ]. However, Rich et al. [27 ] showed a positive role for macrophages in erythropoiesis. They demonstrated a release of an erythropoietic-stimulating factor similar to EPO from macrophages treated with silica. Therefore, there is a possibility that silica and CL2 MDP-liposome treatments may provide opposite effects on erythropoiesis. In contrast to CL2MDP-liposome used in the present study, silica has been shown to stimulate macrophages to produce various cytokines including IL-1, IL-6, and TNF-{alpha} [9 ].

Using a combination of F4/80 and anti-Forssman glycosphingolipid mAb, hematopoietic tissue macrophages could be classified into Frossman+F4/80+ and Forssman-F4/80+ subpopulation [25 ]. Forssman+F4/80+ macrophages have been considered more mature than Forssman-F4/80+ macrophages and more functional in attaching developing hematopoietic cells than Forssman- immature macrophages [15 , 28 ]. In mice injected with CL2MDP-liposome, Forssman-F4/80+ macrophages recovered in the red pulp, but Forssman+F4/80+ macrophages did not reappear even 2 weeks after the treatment. This change in the hematopoietic microenvironment may account for finding that the splenic erythropoietic activity recovered more slowly in the phlebotomized mice treated with CL2MDP-liposome than the control phlebotomized mice.

Bone marrow macrophages have been shown to produce EPO [29 ]. This is a particularly intriguing issue because even small quantities of EPO produced locally may contribute to effective erythropoiesis. However, the present RT-PCR study showed that no EPO message was detected in the spleen in normal, phlebotomized mice, or phlebotomized mice with CL2MDP liposome, and it could be detected easily in kidney in all mice examined. These findings suggested that local EPO production might not be involved in splenic erythropoiesis, but we cannot rule out the possibility because hypoxia has been shown to regulate various macrophage activities [30 ]. Higher EPO levels in phlebotomized mice with CL2MDP-liposome injection than those in phlebotomized mice without CL2MDP-liposome might be because of decreases in EPO consumption for erythropoiesis in phlebotomized mice with CL2MDP-liposome.

The mechanism of splenic CFU-E reduction in CL2MDP-liposome-treated mice remains unknown. Apoptosis may be involved in the erythroid suppression, because the number of cells stained with the anti-active form of caspase-3 antibodies increased in splenic red pulp at day 4 [19 ]. Direct side effects on CFU-E of CL2MDP and CL2MDP-liposome can be ruled out based on the following reasons [9 , 10 ]. (1) Free CL2MDP is a strongly hydrophilic molecule and cannot cross cell membranes. (2) CL2MDP has a short half-life in circulation. (3) Even concentrations of CL2MDP over the theoretically maximum concentration in serum had no significant inhibitory effect on in vitro colony formation of CFU-E. (4) No suppressive effects on splenic erythropoiesis were observed in phlebotomized mice injected with CL2MDP solution (23.2 mg/mouse).

The finding that injection with a high dose of EPO (total 600 U/mouse) restored splenic CFU-E number by up to one-fourth suggested that, if without macrophages, splenic erythropoiesis requires high concentrations of EPO as in the in vitro case. Thus, in mouse splenic erythropoiesis, cooperative regulation of erythropoiesis by EPO and macrophages is suggested. Based on the finding that splenic red pulp macrophages are able to form erythroblastic islands, adhering to erythroblasts partly via very late antigen (VLA)-4/vascular cell adhesion molecule (VCAM)-1 interactions [8 ], this type of adhesive interaction may occur between macrophages and erythroid precursors and play an important role in the maintenance of CFU-E numbers and differentiation of erythroid cells under the conditions of low EPO concentrations.

In the present experimental system using phlebotomy, the effects of CL2MDP-liposomes had centered on splenic erythropoiesis. However, the treatment also influenced other types of splenic hematopoiesis, including granulopoiesis, which were evaluated by CFU-GM assay. Although a slight leukocytosis, primarily due to an increase in the number of neutrophil series, was observed (data not shown), injection of CL2MDP-liposomes suppressed the expected increase in splenic CFU-GM number. This finding suggests the possibility that macrophages contribute to granulopoiesis as well as erythropoiesis, as has been previously suggested [7 , 28 ].

In conclusion, the present study may be an excellent experimental model for further characterization of the in vivo role of splenic macrophages in erythropoiesis.


   ACKNOWLEDGEMENTS
 
This work was supported by a Grant-in-Aid from the Ministry of Education, Science, Sports, and Culture of Japan and a project grant from Kawasaki Medical School.

Received May 27, 1999; revised April 22, 2000; accepted May 3, 2000.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wolf, N. S., Trentin, J. J. (1968) Hemopoietic colony studies. V. Effect of hemopoietic organ stroma on differentiation of pluripotent stem cells J. Exp. Med. 127,205-214[Abstract]
  2. Broudy, V. C., Lin, N. L., Priestley, G. V., Nocka, K., Wolf, N. S. (1996) Interaction of stem cell factor and its receptor c-kit mediates lodgment and acute expansion of hematopoietic cells in the murine spleen Blood 88,75-81[Abstract/Free Full Text]
  3. Pannacciulli, I. M., Massa, G. G., Saviane, A. G., Ghio, R. L., Bianchi, G. L., Bogliolo, G. V. (1977) Effect of bleeding on in vivo and in vitro colony-forming hemopoietic cells Acta Haematol. (Basel) 58,27-33
  4. Pantel, K., Loeffler, M., Bungart, B., Wichmann, H. E. (1990) A mathematical model of erythropoiesis in mice and rats. Part 4: differences between bone marrow and spleen Cell Tissue Kinet. 23,283-297[Medline]
  5. Bessis, M., Breton-Gorius, J. (1962) Iron metabolism in the bone marrow as seen by electron microscopy: a critical review Blood 19,635-663[Abstract/Free Full Text]
  6. Allen, T. D., Dexter, T. M. (1984) The essential cells of the hemopoietic microenvironment Exp. Hematol. 12,517-521[Medline]
  7. Crocker, P. R., Gordon, S. (1985) Isolation and characterization of resident stromal macrophages and hematopoietic cell clusters from mouse bone marrow J. Exp. Med. 162,993-1014[Abstract/Free Full Text]
  8. Sadahira, Y., Yoshino, T., Monobe, Y. (1995) Very late activation antigen 4-vascular cell adhesion molecule 1 interaction is involved in the formation of erythroblastic islands J. Exp. Med. 181,411-415[Abstract/Free Full Text]
  9. van Rooijen, N., Sanders, A. (2000) Elimination, blocking, and activation of macrophages: three of a kind? J. Leukoc. Biol. 68,000-000
  10. van Rooijen, N., Sanders, A. (1994) Liposomes mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications J. Immunol. Methods 174,83-93[Medline]
  11. van Rooijen, N., Kors, N., Kraal, G. (1989) Macrophage subset repopulation in the spleen: differential kinetics after liposomes-mediated elimination J. Leukoc. Biol. 45,97-104[Abstract]
  12. Naito, M., Nagai, H., Kawano, S., Umezu, H., Zhu, H., Moriyama, H., Yamamoto, T., Takatsuka, H., Takei, Y. (1996) Liposomes-encapsulated dichloromethylene diphosphonate induces macrophage apoptosis in vivo and in vitro J. Leukoc. Biol. 60,337-344[Abstract]
  13. Gregory, C. J. (1976) Erythropoietin sensitivity as a differentiation marker in the hemopoietic system: studies of three erythropoietic colony responses in culture J. Cell. Physiol. 89,289-301[Medline]
  14. Sadahira, Y., Hirao, Y., Uehira, K., Kimoto, T. (1991) Immunoelectron microscopic detection of band 3 protein during erythroid cell differentiation by a monoclonal antibody Cell Struct. Funct. 16,141-147[Medline]
  15. Sadahira, Y., Yasuda, T., Kimoto, T. (1991) Regulation of Forssman antigen expression during maturation of mouse stromal macrophages in haematopoietic foci Immunology 73,498-504[Medline]
  16. Austyn, J. M., Gordon, S. (1981) F4/80, a monoclonal antibody directed specifically against the mouse macrophage Eur. J. Immol. 11,805-815
  17. Springer, T., Galfre, G., Secher, D. S., Milstein, C. (1979) Mac-1: a macrophage differentiation antigen by monoclonal antibody Eur. J. Immunol. 9,301-306[Medline]
  18. Holzmann, B., Mclntyre, B., Weissman, I. (1989) Identification of a murine Payer’s patch-specific lymphocyte homing receptor as an integrin molecule with an {alpha} chain homologous to human VLA-4 Cell 56,37-46[Medline]
  19. Ikuta, K., Kina, T., MacNeil, I., Uchida, N., Pesult, B., Chien, Y., Weissman, I. L. (1990) A developmental switch in thymic lymphocyte maturation potential occurs at the level of hematopoietic stem cells Cell 62,863-874[Medline]
  20. Urase, K., Fujita, E., Miho, Y., Kouroku, Y., Mukasa, T., Yagi, Y., Momoi, M. Y., Momoi, T. (1998) Detection of activated caspase-3 (CPP32) in the vertebrate nervous system during development by a cleavage site-directed antiserum Brain Res. Dev. Brain Res. 111,77-87[Medline]
  21. Zhang, F., Gagnon, R. F., Richards, G. K., Brox, A. G. (1996) Anemia of chronic renal failure: characterization in the mouse and correction with human recombinant erythropoietin Nephron 72,625-661
  22. Kabaya, K., Akiyama, H., Nishi, N., Misaizu, T., Okada, Y., Kawagishi, M., Amano, K., Kusaka, M., Seki, M., Uzumaki, H. (1995) Improvement of anemia in W/Wv mice by recombinant human erythropoietin (rHuEPO) mediated through EPO receptors with lowered affinity Life Sci 57,1067-1076[Medline]
  23. Masuda, S., Okano, M., Yamagishi, K., Nagao, M., Ueda, M., Sasaki, R. (1994) A novel site of erythropoietin production: oxygen-dependent production in cultured rat astrocytes J. Biol. Chem. 269,19488-19493[Abstract/Free Full Text]
  24. Sadahira, Y., Mori, M., Awai, M., Watarai, S., Yasuda, T. (1988) Forssman glycosphingolipid as an immunohistochemical marker for mouse stromal macrophages in hematopoietic foci Blood 72,42-48[Abstract/Free Full Text]
  25. Sadahira, Y., Mori, M., Kimoto, T. (1989) Participation of radioresistant Forssman antigen-bearing macrophages in the formation of stromal elements of erythroid spleen colonies Br. J. Haematol. 71,469-474[Medline]
  26. Wang, C. Q., Udupa, K. B., Xiao, H., Lipschitz, D. A. (1994) Evidence suggesting a negative regulatory role for macrophages in murine erythropoiesis in vivo Exp. Hematol. 22,370-376[Medline]
  27. Rich, I. N., Heit, W., Kubanek, B. (1980) An erythropoietic stimulating factor similar to erythropoietin released by macrophages after treatment with silica Blut 40,297-303[Medline]
  28. Mori, M., Sadahira, Y., Kawasaki, S., Hayashi, T., Awai, M. (1990) Macrophage heterogeneity in bone marrow culture in vitro J. Cell Sci. 95,481-485[Abstract/Free Full Text]
  29. Vogt, C., Pentz, S., Rich, I. N. (1989) A role for the macrophage in normal hemopoiesis: III. In vitro and in vivo erythropoietin gene expression in macrophages detected by in situ hybridization. Exp. Hematol. 17,391-397[Medline]
  30. Lewis, J. S., Lee, J. A., Underwood, J. C. E., Harris, A. L., Lewis, C. E. (1999) Macrophage response to hypoxia: relevance to disease mechanism J. Leukoc. Biol. 66,889-900[Abstract]



This article has been cited by other articles:


Home page
 BloodHome page
J. A. Chasis and N. Mohandas
Erythroblastic islands: niches for erythropoiesis
Blood, August 1, 2008; 112(3): 470 - 478.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
M. M. Rhodes, P. Kopsombut, M. C. Bondurant, J. O. Price, and M. J. Koury
Adherence to macrophages in erythroblastic islands enhances erythroblast proliferation and increases erythrocyte production by a different mechanism than erythropoietin
Blood, February 1, 2008; 111(3): 1700 - 1708.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
J. Y. Bertrand, G. E. Desanti, R. Lo-Man, C. Leclerc, A. Cumano, and R. Golub
Fetal spleen stroma drives macrophage commitment
Development, September 15, 2006; 133(18): 3619 - 3628.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sadahira, Y.
Right arrow Articles by Naito, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sadahira, Y.
Right arrow Articles by Naito, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS