


* Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, Pennsylvania;
The Wistar Institute, Philadelphia, Pennsylvania; and
University of Pittsburgh, Department of Infectious Diseases and Microbiology/GSPH, Pittsburgh, Pennsylvania
Correspondence: Velpandi Ayyavoo, Ph.D., University of Pittsburgh, Department of Infectious Diseases and Microbiology/GSPH, 130 DeSoto Street, Pittsburgh, PA 15261. E-mail: Velpandi+{at}pitt.edu
|
|
|---|
B-mediated transcription. NF-
B, a potent transcription factor,
activates many proinflammatory cytokines/chemokines upon infection.
Here, we analyzed the effect of extracellular Vpr as well as the
virion-associated Vpr on ß chemokines (MIP-1
, MIP-1ß, and
RANTES) production in human macrophages and primary lymphocytes (PBLs).
Macrophages and PBLs exposed to HIV-1 vpr+
viruses or to recombinant Vpr protein produced significantly less ß
chemokines compared with cells infected with HIV-1
vpr- viruses or irrelevant control protein
(Gag)-exposed cells. These results suggest that a Vpr-mediated
increase in virus replication could be in part through
down-regulation of chemokine production.
Key Words: HIV-1 Vpr ß chemokine macrophages PBLs
|
|
|---|
Chemokines are members of a family of related proinflammatory
cytokines, which are part of the normal immune responses
[17
]. In the context of HIV-1 infection, they play an
important role by controlling the infection [18
].
Primary cells (CD8+ and macrophages) are believed to play a
critical role in controlling HIV infection by secreting one or more of
the ß chemokines RANTES (regulated on activation, normal T cell
expressed and secreted), macrophage inflammatory protein (MIP)-1
,
and MIP-1ß [19
, 20
]. The exact mechanism
of action of this suppression is mediated by blocking the binding
between the chemokine receptors and viruses [21
,
22
]. Previously, we have demonstrated that Vpr inhibits T
cell proliferation and blocks production of certain cytokines by human
peripheral blood lymphocytes (PBLs) in vitro
[16
]. To further understand the effect of Vpr on other
cellular functions, we analyzed the effect of Vpr on ß chemokines and
its role in viral replication. We demonstrate that HIV-1 Vpr
significantly down-regulates the synthesis and secretion of ß
chemokines in macrophages and lymphocytes. These results indicate that
Vpr-mediated down-regulation of HIV-1 suppressive factors could be one
of the mechanisms by which Vpr upregulates the virus replication in
target cells.
|
|
|---|
Isolation of normal human primary PBLs
Blood from HIV-1-negative healthy donors was used to isolate
PBLs by Ficoll-Hypaque (Pharmacia, Piscataway, NJ) gradient
centrifugation. PBMCs were collected from the interface, and PBLs were
recovered in PBS washings following two rounds of adherence to plastic.
The cells were further purified by negative selection with anti-CD14
magnetic beads (Miltenyi Biotec, Auburn, CA) to remove monocytes. The
purified lymphocytes were resuspended in RPMI 1640, supplemented with
10% heat-inactivated fetal calf serum (FCS), stimulated with
phytohemagglutinin (PHA; 5 µg/ml) for 2 days, and cultured in
interleukin (IL)-2 (5 U/ml) containing medium.
Isolation of macrophages
Mononuclear cells were isolated from the HIV-1-negative healthy
donors by Ficoll-Hypaque density-gradient centrifugation at 1500
g for 45 min. After removing the interface (PBMCs) with a
Pasteur pipette, cells were transferred to a new tube and washed with
plain RPMI media followed by centrifugation three times at 1500
g for 5 min each. After washing, cells were resuspended in
10% human serum in RPMI with 1% penicillin-streptomycin and 1%
glutamine at a concentration of 2 x 106 per ml. The
cells were incubated at 37°C in polysterene T-75 flasks for 5 days.
After incubation, the cells were washed with RPMI three times to remove
nonadherent cells. The adherent monocytes were detached with
ethylenediaminetetraacetic acid (EDTA). The purity of the cell
populations thus isolated was >98%, determined by immunofluorescence
staining for CD14 and CD3 expression. The cells were incubated in
6-well plates at a density of 1 x 106 cells/ml in
RPMI medium supplemented with 10% human serum [24
].
Virus infection studies using HIV-1 vpr+ and
HIV-1 vpr- viruses
To assess the effect of Vpr as a virion-associated molecule, we
have used amphotropic pseudotype viruses with and without Vpr.
Pseudotype viruses were produced by cotransfecting RD cells with pEnv
and pNL43.HSA.R+E- or
pNL43.HSA.R-E-. Cells (PBLs) were
subsequently infected with HIV-1 env-complemented,
vpr+ or vpr- viruses. To
infect macrophages, we have complemented
pNL43.HSA.R+E- or
pNL43.HSA.R-E- proviral DNA with pVSV-G-Env.
RD cells were transfected with pVSV-G-Env with
pNL43.HSA.R+E- or
pNL43.HSA.R-E-. Seventy-two hours
posttransfection, supernatant was collected, concentrated, and assayed
for virus production by measuring the p24 antigen released into the
medium. PBLs (5x106) or macrophages (1x106)
were infected with 10 pg of p24 antigen-equivalent viruses for 4 h, washed thoroughly with plain RPMI medium, and resuspended in the
appropriate growth medium. Env-complemented pseudotype viruses undergo
a single round of infection within the target cells, which allows study
of the Vpr-mediated effects in the absence of viral-mediated killing.
Recombinant Vpr protein production and purification
HIV-1 vpr gene was PCR-amplified using primers Vpr
(+) 5' ACGGATCCATGGAACAAGCCCCAGA 3' and Vpr (-) 5' TGGATCTACTGGCTCCATT
3', and cloned into pBlue Bak His vector (Clontech, Palo Alto, CA).
Vpr-6X His tag expression plasmid and AcNPV vector were cotransfected
into Sf 9 cells using the baculovirus-expression vector
system (BaculoGold, PharMingen, San Diego, CA). The
baculovirus-expressed recombinant protein was purified from
Sf 9 cells at 72 h postinfection by using Talon
metal-affinity resin (Clontech). The purity and specificity determined
by using sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS/PAGE) were 95%; this was confirmed further by western blot using
rabbit polyclonal anti-Vpr antibody.
HIV-1 Vpr treatment
Highly purified (>95%) recombinant Vpr was used to study the
effect of extracellular Vpr protein. To establish dose profiles, Vpr
protein was used at 0, 0.1, 1, 10, and 100 pg/ml concentrations. For
time-course experiments in PBLs and macrophages, Vpr (100 pg/ml) was
incubated with cells for 0, 1, 2, 4, 6, 12, 24, and 48 h. Normal
human PBLs and macrophages were treated with different concentrations
of Vpr protein or control protein Gag (baculovirus-made Gag, NIH AIDS
RRRP) for 6 h, washed with phosphate-buffered saline (PBS), and
resuspended in RPMI medium with 10% FBS. Supernatant from the treated
cells was collected every 24 h for subsequent measurement of
ß-chemokine secretion by enzyme-linked immunosorbent assay (ELISA).
Negative controls included mock (PBS) and irrelevant protein (Gag)
treatment.
Infection
Cells (macrophages and PBLs) were infected with
pEnv-complemented pseudotype HIV-1 vpr+ or HIV-1
vpr- viruses. This system has been used
successfully by many investigators to study the effects of
virion-associated gene products on host cells [25
].
Purified PBLs and macrophages were infected with 10 pg of p24
antigen-equivalent viruses, a dose that we have tested previously. Four
hours postinfection, cells were washed three times with PBS and
resuspended in RPMI medium supplemented with IL-2. Samples were
collected at 24 h intervals and stored at -20°C to assess
ß-chemokine secretion.
Quantitation of secreted chemokines by ELISA
Quantitation of chemokines present in the supernatant was done
using capture ELISA. We measured MIP-1
, MIP-1ß, and RANTES within
the culture supernatants. The chemokine assay kits were purchased from
R&D Systems (Minneapolis, MN), and the assay was performed according to
the manufacturers protocol. Briefly, supernatants from the infected
cell cultures were added to the wells in triplicate at different
dilutions and incubated at 37°C for 23 h, followed by washing and
incubation with detection antibodies for 1 h. Bound antibodies
were developed by the addition of 3',3',5',5'-Tetramethyl-benzidine
(TMB) peroxidase substrate and detected at 450 nm in an ELISA plate
reader.
Effect of Vpr as virion-associated molecule on chemokine mRNA
synthesis in infected cells by RNase protection assay
Human PBMCs were infected with pNL43
R+E- or pNL43 R-E-
viruses. Two days postinfection, cells were collected, and total RNA
was isolated using RNAgent RNA Isolation kit (Promega, Madison, WI).
After precipitation with isopropanol, the RNA was rinsed with 70%
ethanol, air dried, and resuspended in diethyl pyrocarbonate
(DEPC)-treated water. Total RNA was measured by absorption
spectrophotometry at 260 nm. The A260/A280
ratio averaged 1.71.8. RNase protection analysis was carried out with
the use of RiboQuant Multi-Probe RNase Protection Assay System
(PharMingen). Briefly, unlabeled sense RNA probes, encoding for
lymphotactin (LTN), MIP-
, MIP-ß, monocyte chemoattractant protein
(MCP)-1, RANTES, IL-8, interferon (IF)-inducible protein (IP-10),
I-309, mouse ribosomal protein 32 (L-32), and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were used for the
assay.
For synthesis of radiolabeled antisense RNA, the final reaction mixture
(20 µl) contained 100 µCi [
-32P] uridine
5'-triphosphate (UTP; 3000 Ci/mmol; NEN, Cambridge, MA); 10 µmol UTP;
500 µmol each guanosine 5'-triphosphate (GTP), adenosine
5'-triphosphate (ATP), and cytidine 5'-triphosphate (CTP); 10 µmol
dithiothreitol; 1 x transcription buffer; 12 U RNasin; 8 U T7
polymerase; and an equimolar pool of linearized template. After 1 h at 37°C, the mixture was treated with DNase buffer (90 µl) and
RQ1 RNase-free DNase for 30 min at 37°C, and the probes were purified
by extractions with phenol-chloroform and chloroform, and precipitation
with ethanol; and were dried under vacuum. Dried probes were dissolved
(3x105 counts/min1/µl1) in
hybridization buffer and added (2 µl; 3x105
counts/min1/µl1) to tubes containing
experimental sample RNA (10 µg) dissolved in 8 µl hybridization
buffer. The samples were heated at 80°C for 3 min and incubated at
56°C for 16 h. The single-stranded RNA was then digested by
addition of a solution (100 µl) of RNase and RNase T1. After
incubation (30 min at 37°C), the samples were treated with 18 µl of
a mixture of proteinase-K (1 mg/ml), SDS (5%), and yeast tRNA (200
µg/ml). The samples were extracted with Tris-saturated phenol and
chloroform: isoamyl alcohol and precipitation with ethanol. The samples
were dissolved in 5 µl gel-loading buffer (80% formamide, 1 mM EDTA,
pH 8.0, 0.1% bromophenol, and 0.1% xylene cyanol), heated to 90°C
for 3 min, and subjected to electrophoresis in standard 5%
acrylamide-8 M urea-sequencing gels. Dried gels were placed on XAR film
(Eastman Kodak, Rochester, NY) with intensifying screens and were
developed at 80°C for 18 h. The GAPDH mRNA was used as an
internal standard to determine equivalent amounts of RNA used in
parallel reactions. All experiments were repeated at least two
different times (24 and 48 h), using RNA isolated from at least
two different experimental setups.
|
|
|---|
, MIP-1ß, and RANTES.
The chemokine profiles are presented in Figure 1
. Inhibition of chemokine production was significant at 100 pg/ml
concentration, whereas no effect was observed at 0.1 pg/ml. Production
of RANTES (20-fold), MIP-1
(4-fold), and MIP-1ß (5-fold) was
reduced in Vpr-treated cells at a concentration of 100 pg/ml, in
comparison with control protein (Gag)-treated or -untreated cells. This
suppressive effect was directly correlated with increasing Vpr
concentration. For instance, MIP-1
concentration was 4- and 2.5-fold
lower when Vpr was added at a concentration of 100 and 10 pg/ml,
whereas almost no effect was seen when Vpr was added at 0.1 pg/ml
concentration.
![]() View larger version (38K): [in a new window] |
Figure 1. Effect of rVpr protein on ß-chemokine production in PBLs.
Ficoll-Hypaque-fractionated human PBLs (1x106) were
stimulated with PHA (5 µg/ml) and incubated in the presence of
different concentrations (pg/ml) of pure rVpr protein or control
protein (Gag). Cell-free supernatants were collected at every 24 h
interval posttreatment and assayed for the release of ß chemokines
RANTES, MIP-1 , and MIP-1ß in the medium. The mean of triplicate
samples from one experiment is shown; these experiments were repeated
multiple times, and similar results were obtained.
|
![]() View larger version (26K): [in a new window] |
Figure 2. Specificity of Vpr-mediated inhibition of chemokine production in human
primary PBLs. Normal human PBLs were purified as described in Materials
and Methods and treated with 100 pg/ml concentration of recombinant Vpr
protein in the presence and absence of Vpr-specific polyclonal rabbit
sera (AB) at a dilution of 1:100 or preimmune rabbit sera (PRS).
Negative control protein (Gag) was also treated with vpr specific (AB)
and pre immune sera (PRS). Cell-free supernatants were collected at
48 h posttreatment and assayed for the release of ß chemokines
RANTES, MIP-1 , and MIP-1ß in the medium. Data represent the
mean ± SD of four experiments conducted in
triplicate.
|
), and 704.4 ± 28.9 pg/ml (MIP-1ß), compared with
667.4 ± 33.6 pg/ml (RANTES), 241.8 ± 32.1 pg/ml (MIP-1
),
and 302.7 ± 29.1 pg/ml (MIP-1ß) produced by cells infected with
vpr+ virus (Fig. 3A
). In a similar way, macrophages infected with Vpr+
virus inhibited the production of RANTES (267.38±32.1 pg/ml), MIP-1
(321.12±33 pg/ml), and MIP-1ß (421.11±33.2 pg/ml) when compared
with virus infected with Vpr-, which produced 753.93 ± 32 pg/ml
RANTES and 903 ± 32.14 pg/ml, and 845 ± 33.12 pg/ml for
MIP-1
and MIP-1ß, respectively (Fig. 3B) . Cells infected with
HIV-1 vpr+ virus produced three- to four-fold
lower levels of chemokines compared with vpr-
virus-infected cells.
![]() ![]() View larger version (42K): [in a new window] |
Figure 3. (A) Effect of HIV-1 vpr+ and
vpr- virus on ß-chemokine production on PBLs.
Ficoll-Hypaque-fractionated normal human PBLs (1x106) were
stimulated with PHA (5 µg/ml) and infected with HIV-1
R+E- and HIV-1 R-E-
amphotropic pseudoviruses, as described in Materials and Methods.
Cell-free supernatants were collected at 48 h posttreatment and
assayed for the release of ß chemokines RANTES, MIP-1 , and
MIP-1ß in the medium. The mean of triplicate samples from one
experiment is shown; these experiments were repeated multiple times,
and similar results were obtained. (B) Effect of HIV-1
vpr+ and vpr- virus on
ß-chemokine production on macrophages. Purified human macrophages
(1x106) were grown with RPMI medium supplemented with 10%
human serum and infected with HIV-1 R+E- and
HIV-1 R-E- pseudoviruses, complemented with
pVSV-G Env as described in Materials and Methods. Cell-free
supernatants were collected at every 24 h interval posttreatment
and assayed for the release of ß chemokines RANTES, MIP-1 , and
MIP-1ß in the medium. The mean of triplicate samples from one
experiment is shown here. These experiments were repeated multiple
times, and similar results were obtained.
|
, and MIP-1ß secretion in the infected
PBLs and macrophages peaked at 2448 h after infection (unpublished
results). The production of MIP-1
and MIP-1ß was comparable in
lymphocytes and macrophages. However, RANTES secretion in macrophages
was lower than PBLs, because macrophages are not a significant source
of RANTES production [26
].
We next examined whether Vpr blocked the secretion of chemokine or
inhibited the synthesis of chemokine mRNA. HIV-1
vpr+ and vpr-
virus-infected cells (from the above experiments) were used as a source
for RNA isolation. RNase protection assay was performed to examine
specific mRNA levels. HIV-1 vpr+ virus-infected
cells show significantly lower amounts of messages for several ß
chemokines (including RANTES, MIP-1
, MIP-1ß, IL-8, and I-309)
compared with vpr- virus-infected or
-uninfected cells (Fig. 4
), suggesting that Vpr affects the synthesis and secretion of
chemokines by transcriptional control. Further analysis indicates that
Vpr down-regulates chemoattractants for naive T cells and neutrophils
(IL-8), CD8 T cells (MIP-1
and IL-10), monocytes (I-309), and CD4
memory T cells (RANTES). However, Ltn (lymphotactin), a chemoattractant
for pre-T cells to the thymus, was not altered by Vpr.
![]() View larger version (30K): [in a new window] |
Figure 4. Effect of HIV-1 vpr+ and
vpr- virus on ß-chemokine RNA in infected
total PBMCs. Human PBMCs were infected with HIV-1
vpr+ and HIV-1 vpr-
pseduotype viruses. Forty-eight hours postinfection, cells were
collected, total RNA was isolated from the infected cells, and RNase
protection assay was performed as described in Materials and Methods.
Lane Vpr (-), PBMCs infected HIV-1 vpr-
viruses; lane Vpr (+), PBMCs infected with HIV-1
vpr+ viruses.
|
|
|
|---|
On the cellular level, HIV-1 vpr exerts significant
effects on cellular proliferation, differentiation, regulation of
apoptosis, modulation of cytokine production, and suppression of host
cell-mediated NF-
B transcription [16
]. Primary
lymphocytes (CD4+) and macrophages/dentritic cells are the
major reservoirs for HIV-1 infection [32
,
33
]. Interestingly, they are also the prime immune cells
that play a significant role in immune activation upon infection. They
release many proteins, namely, cytokines and chemokines, which are
proinflammmatory and antiviral [34
]. Chemokines are
members of a family of related proinflammatory cytokines, which have a
variety of biological properties, including chemotaxis and activation
[35
]. Chemokines are important particularly in the
molecular regulation of leukocyte trafficking from the lymph nodes to
the site of inflammation or infection. Activation of these factors is
controlled mainly by NF-
B-mediated transactivation upon stimuli. Our
results indicate that Vpr, provided as an extracellular protein or as a
virion-associated molecule, is capable of down-regulating the synthesis
and secretion of ß chemokines. However, the exact mechanism by which
Vpr inhibits chemokines synthesis/secretion is not completely
understood. This could be a direct effect at the transcriptional level
or an indirect effect by inhibiting the transcription factors such as
NF-
B [16
, 36
]. Studies using mutant
NF-
B binding sites and I
B
competition have shown that
transcription factors, such as NF-
B and SP-1, are important for
RANTES gene expression [37
].
Chemokines, in addition to activating inflammatory responses, also have antiviral activity against HIV-1 through interfering with HIV-1 natural ligands [38 , 39 ]. Previous studies have clearly shown that Vpr increases viral replication in vitro and in vivo [5 , 40 , 41 ]. Results presented in Figures 1 2 3 demonstrate that Vpr as a viral protein or as a virion-associated molecule inhibits ß-chemokine production in human primary cells, including human macrophages. Conversely, the virus production was also enhanced in the same culture (unpublished results). Based on our observation, it is also conceivable that Vpr could interfere with ß-chemokine production to increase virus production. In conclusion, this study shows that one of the HIV-1 virion-associated accessory proteins, Vpr, could play a significant role in modulating the host immune system as well as influencing the viral replication to benefit the virus. Understanding the mechanism by which Vpr mediates these immune evasion strategies would open new avenues for the development of novel therapeutic agents.
|
|
|---|
, and MIP-1ß as the major HIV-suppressive factors produced by CD8+ T cells Science (Wash., D.C.) 270,1811-1815
and MIP-1ß receptor as a fusion cofactor for macrophage-tropic HIV-1 Science (Wash., D.C.) 272,1955-1958[Abstract]
B potently up-regulates the promoter activity of RANTES, a chemokine that blocks HIV infection J. Immunol. 158,3483-3491[Abstract]This article has been cited by other articles:
![]() |
N. Hiramatsu, K. Hiromura, T. Shigehara, T. Kuroiwa, H. Ideura, N. Sakurai, S. Takeuchi, M. Tomioka, H. Ikeuchi, Y. Kaneko, et al. Angiotensin II Type 1 Receptor Blockade Inhibits the Development and Progression of HIV-Associated Nephropathy in a Mouse Model J. Am. Soc. Nephrol., February 1, 2007; 18(2): 515 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Giri, M. Nebozhyn, L. Showe, and L. J. Montaner Microarray data on gene modulation by HIV-1 in immune cells: 2000-2006 J. Leukoc. Biol., November 1, 2006; 80(5): 1031 - 1043. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Wieland, S. Florquin, J. M. Pater, S. Weijer, and T. van der Poll CD4+ Cells Play a Limited Role in Murine Lung Infection with Mycobacterium kansasii Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 167 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Muthumani, D. S. Hwang, A. Y. Choo, S. Mayilvahanan, N. S. Dayes, K. P. Thieu, and D. B. Weiner HIV-1 Vpr inhibits the maturation and activation of macrophages and dendritic cells in vitro Int. Immunol., February 1, 2005; 17(2): 103 - 116. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wahl, T. Greenwell-Wild, G. Peng, G. Ma, J. M. Orenstein, and N. Vazquez Viral and host cofactors facilitate HIV-1 replication in macrophages J. Leukoc. Biol., November 1, 2003; 74(5): 726 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fantuzzi, F. Belardelli, and S. Gessani Monocyte/macrophage-derived CC chemokines and their modulation by HIV-1 and cytokines: A complex network of interactions influencing viral replication and AIDS pathogenesis J. Leukoc. Biol., November 1, 2003; 74(5): 719 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Muthumani, D. S. Hwang, B. M. Desai, D. Zhang, N. Dayes, D. R. Green, and D. B. Weiner HIV-1 Vpr Induces Apoptosis through Caspase 9 in T Cells and Peripheral Blood Mononuclear Cells J. Biol. Chem., September 27, 2002; 277(40): 37820 - 37831. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Montaner, C.-F. Perno, and S. Crowe Macrophage infection by HIV-1: focus on viral reservoirs and pathogenesis J. Leukoc. Biol., September 1, 2000; 68(3): 301 - 302. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||